G626664



Basic Information


Item Value
gene id G626664
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 56873344 ~ 56873604 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU712602
attggtgggcagaactgaaaaagcgtgtgcgagcaaggaggcctacaaacctgactcagttacaccagctctgtcaggaggaatgggccaaaattcacccaacttattgtggtaagcttgtggaaggctacctgaaacatttgacccaagttaaacaatttaaaggcaatgctaccaaatactaattgtgtgtatgtaaacttctgacccactgggaatgtgatgaaagaaattaaagctgaaataaataattctctctac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU712602 True 261 lncRNA 0.41 1 56873344 56873604

Neighbor


gene id symbol gene type direction distance location
LOC110528976 LOC106583066 coding upstream 23895 56848506 ~ 56849449 (+)
LOC110528032 LOC106583134 coding upstream 31201 56817281 ~ 56842143 (+)
LOC110528029 mdm4 coding upstream 114121 56750804 ~ 56766586 (+)
ppfia4 LOC106583137 coding upstream 156531 56605892 ~ 56716813 (+)
mdfi LOC106583052 coding upstream 497282 56375199 ~ 56376062 (+)
LOC110528036 LOC106583132 coding downstream 144941 57018545 ~ 57029242 (+)
fbxo2 LOC106583126 coding downstream 172896 57046500 ~ 57052885 (+)
wnt4a1 wnt4a1 coding downstream 338036 57211640 ~ 57240084 (+)
snrpe ruxe coding downstream 446065 57319669 ~ 57323047 (+)
LOC100135783 LOC100135783 coding downstream 462994 57336598 ~ 57405253 (+)
G626663 NA non-coding upstream 69 56873050 ~ 56873275 (+)
G626661 NA non-coding upstream 1070 56872066 ~ 56872274 (+)
G626645 NA non-coding upstream 37485 56835648 ~ 56835859 (+)
G626642 NA non-coding upstream 38666 56834354 ~ 56834678 (+)
G626670 NA non-coding downstream 5804 56879408 ~ 56879677 (+)
G626671 NA non-coding downstream 7734 56881338 ~ 56886168 (+)
G626685 NA non-coding downstream 22613 56896217 ~ 56896490 (+)
G626681 NA non-coding downstream 23966 56897570 ~ 56898524 (+)
G626736 NA non-coding downstream 159294 57032898 ~ 57034935 (+)
G626417 NA other upstream 388040 56482394 ~ 56485304 (+)
G626004 NA other upstream 794415 56071054 ~ 56078929 (+)
LOC110528024 LOC106583050 other upstream 1158633 55711635 ~ 55714713 (+)
G625222 NA other upstream 1400501 55472468 ~ 55472843 (+)
G625038 NA other upstream 1659433 55211705 ~ 55213911 (+)
G627035 NA other downstream 669278 57542882 ~ 57596051 (+)
LOC110528055 LOC106583107 other downstream 1044430 57917801 ~ 58055214 (+)
LOC110528980 LOC106583093 other downstream 1629946 58502198 ~ 58589001 (+)
G628468 LOC106583084 other downstream 1834691 58708295 ~ 58713584 (+)

Expression


G626664 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G626664 Expression in each Bioproject

Bar chart with 20 bars.
G626664 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network