G628011



Basic Information


Item Value
gene id G628011
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 57861928 ~ 57862168 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU714070
tttatgtacatattcgttatccccttacacttgtagtaaggtagtagttttggaattgttagctagattacttgttggttattactgcattgttggaactagaagcacaagcatttcactacactcgcattaacatctgctaaccatgtgtatgtgacaaataaaatttgatttgatttttatttgatcatgttgtggggctgctttcctgcaggagggactggtgcacttcacaatatag

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU714070 True 241 lncRNA 0.37 1 57861928 57862168

Neighbor


gene id symbol gene type direction distance location
LOC110528053 nucks1 coding downstream 56660 57794775 ~ 57805268 (-)
LOC110528052 LOC106583108 coding downstream 72769 57782135 ~ 57789159 (-)
LOC110528051 LOC106583109 coding downstream 103397 57752075 ~ 57758531 (-)
LOC110528050 LOC106583110 coding downstream 132611 57712894 ~ 57729317 (-)
LOC110528047 NA coding downstream 259827 57579045 ~ 57602101 (-)
LOC110528056 LOC106583106 coding upstream 259388 58121556 ~ 58138678 (-)
LOC110528058 LOC106583105 coding upstream 317690 58179858 ~ 58192254 (-)
LOC110528061 mfap2 coding upstream 371288 58233456 ~ 58239552 (-)
LOC110528062 LOC106583101 coding upstream 380529 58242697 ~ 58253037 (-)
LOC110528063 LOC106583099 coding upstream 404567 58266735 ~ 58276595 (-)
G627835 NA non-coding downstream 151083 57710487 ~ 57710845 (-)
LOC110528045 LOC106583117 non-coding downstream 320309 57461920 ~ 57541619 (-)
G627714 NA non-coding downstream 344781 57514808 ~ 57517147 (-)
G628013 NA non-coding upstream 1191 57863359 ~ 57863604 (-)
G628018 NA non-coding upstream 3754 57865922 ~ 57866160 (-)
G628592 NA non-coding upstream 37634 57899802 ~ 57954090 (-)
G628649 NA non-coding upstream 135683 57997851 ~ 58005983 (-)
G628654 NA non-coding upstream 137820 57999988 ~ 58008064 (-)
LOC110528040 NA other downstream 803358 57052191 ~ 57059527 (-)
vamp3 vamp3 other downstream 992477 56853567 ~ 56869607 (-)
G627323 NA other downstream 1009627 56846962 ~ 56852301 (-)
G627314 NA other downstream 1026836 56834350 ~ 56835092 (-)
G627254 NA other downstream 1165837 56691323 ~ 56696091 (-)
G628575 LOC106579815 other upstream 9882 57872050 ~ 57873331 (-)
G628714 NA other upstream 255022 58117190 ~ 58118122 (-)
LOC110528069 LOC106583062 other upstream 564007 58425680 ~ 58437154 (-)
LOC110528083 LOC106583085 other upstream 829649 58691817 ~ 58695856 (-)
sfrs3 sfrs3 other upstream 845404 58707572 ~ 58713630 (-)

Expression



Co-expression Network