G628654



Basic Information


Item Value
gene id G628654
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 57999988 ~ 58008064 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU714794
gtcttctccttgcatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatactatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccggctttaaacttcttcacaacagtatgtcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggaccgctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagttttggatttgttaaaaaagtttgaaat

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU714794 True 451 lncRNA 0.42 2 57999988 58008064
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528053 nucks1 coding downstream 194720 57794775 ~ 57805268 (-)
LOC110528052 LOC106583108 coding downstream 210829 57782135 ~ 57789159 (-)
LOC110528051 LOC106583109 coding downstream 241457 57752075 ~ 57758531 (-)
LOC110528050 LOC106583110 coding downstream 270671 57712894 ~ 57729317 (-)
LOC110528047 NA coding downstream 397887 57579045 ~ 57602101 (-)
LOC110528056 LOC106583106 coding upstream 113492 58121556 ~ 58138678 (-)
LOC110528058 LOC106583105 coding upstream 171794 58179858 ~ 58192254 (-)
LOC110528061 mfap2 coding upstream 225392 58233456 ~ 58239552 (-)
LOC110528062 LOC106583101 coding upstream 234633 58242697 ~ 58253037 (-)
LOC110528063 LOC106583099 coding upstream 258671 58266735 ~ 58276595 (-)
G628592 NA non-coding downstream 45898 57899802 ~ 57954090 (-)
G628018 NA non-coding downstream 133828 57865922 ~ 57866160 (-)
G628013 NA non-coding downstream 136384 57863359 ~ 57863604 (-)
G628011 NA non-coding downstream 137820 57861928 ~ 57862168 (-)
G628596 NA non-coding upstream 5619 58013683 ~ 58016772 (-)
G628681 NA non-coding upstream 43920 58051984 ~ 58055214 (-)
G628697 NA non-coding upstream 84983 58093047 ~ 58093260 (-)
G628700 NA non-coding upstream 88138 58096202 ~ 58096437 (-)
G628705 NA non-coding upstream 98676 58106740 ~ 58106998 (-)
G628575 LOC106579815 other downstream 126657 57872050 ~ 57873331 (-)
LOC110528040 NA other downstream 941418 57052191 ~ 57059527 (-)
vamp3 vamp3 other downstream 1130537 56853567 ~ 56869607 (-)
G627323 NA other downstream 1147687 56846962 ~ 56852301 (-)
G627314 NA other downstream 1164896 56834350 ~ 56835092 (-)
G628714 NA other upstream 109126 58117190 ~ 58118122 (-)
LOC110528069 LOC106583062 other upstream 418111 58425680 ~ 58437154 (-)
LOC110528083 LOC106583085 other upstream 683753 58691817 ~ 58695856 (-)
sfrs3 sfrs3 other upstream 699508 58707572 ~ 58713630 (-)
G630132 NA other upstream 1739386 59747450 ~ 59752591 (-)

Expression


G628654 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G628654 Expression in each Bioproject

Bar chart with 18 bars.
G628654 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network