XLOC_025469 (fthl31)


Basic Information

Item Value
gene id XLOC_025469
gene name fthl31
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 32129632 ~ 32130455 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00050216
ATGGAGACTTGTCAGATTCGCCAGAACTACGATCGTGACTGCGAGGCTGCGATCAACAAGATGATCAATCTGGAGCTTTACGCTGGATACACCTACACCTCCATGGCTCACTACTTCAAACGGGACGATGTGGCCCTTCCTGGATTTGCCAAGTTCTTCAATAAGAACAGCGAGGAGGAGCGCGAACATGCTGAGAAATTCATGGAGTTCCAGAACAAGAGAGGTGGACGCATTGTCCTTCAGGACATCAAGGTGCTTTTCCTGTCATGTATTATTTAA

Function

symbol description
fthl31 Predicted to enable ferric iron binding activity and ferrous iron binding activity. Predicted to be involved in intracellular sequestering of iron ion. Predicted to act upstream of or within cellular iron ion homeostasis and iron ion transport. Predicted to be active in cytoplasm.

GO:

id name namespace
GO:0006879 cellular iron ion homeostasis biological_process
GO:0006880 intracellular sequestering of iron ion biological_process
GO:0006826 iron ion transport biological_process
GO:0005737 cytoplasm cellular_component
GO:0005506 iron ion binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0008198 ferrous iron binding molecular_function
GO:0008199 ferric iron binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-428 Predicted to enable ferric iron binding activity and ferrous iron binding activity. Predicted to be involved in intracellular sequestering of iron ion. Predicted to act upstream of or within cellular iron ion homeostasis and iron ion transport. Predicted to be active in cytoplasm.

Ensembl:

ensembl_id ENSDARG00000113150

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00050216 True 279 mRNA 0.48 2 32129632 32130455

Neighbor

gene id symbol gene type direction distance location
XLOC_025468 fthl29 coding upstream 2049 32125452 ~ 32127583 (+)
XLOC_025467 fthl31 coding upstream 9278 32118670 ~ 32120354 (+)
XLOC_025466 fthl30 coding upstream 15984 32112004 ~ 32113648 (+)
XLOC_025465 fthl28 coding upstream 22960 32105175 ~ 32106672 (+)
XLOC_025464 fthl27 coding upstream 28633 32099507 ~ 32100999 (+)
XLOC_025470 BX511021.1 coding downstream 4582 32135037 ~ 32136228 (+)
XLOC_025471 fthl27 coding downstream 9211 32139666 ~ 32140446 (+)
XLOC_025472 syt5a coding downstream 11927 32142382 ~ 32151167 (+)
XLOC_025473 NA coding downstream 163318 32293773 ~ 32297003 (+)
XLOC_025474 prl coding downstream 211462 32341917 ~ 32345900 (+)
XLOC_025429 BX649540.1 misc upstream 1880596 30248739 ~ 30249036 (+)
XLOC_025458 NA non-coding upstream 210501 31918162 ~ 31919131 (+)
XLOC_025455 BX324157.1 non-coding upstream 340995 31788521 ~ 31788637 (+)
XLOC_025449 NA non-coding upstream 890069 31231809 ~ 31239563 (+)
XLOC_025447 NA non-coding upstream 958758 31169219 ~ 31170874 (+)
XLOC_025446 NA non-coding upstream 1023979 31097933 ~ 31105653 (+)
XLOC_025475 NA non-coding downstream 215679 32346134 ~ 32347493 (+)
XLOC_025481 CR936975.1 non-coding downstream 344206 32474661 ~ 32477285 (+)
XLOC_025487 FP236454.1 non-coding downstream 440854 32571309 ~ 32571371 (+)
XLOC_025492 NA non-coding downstream 521242 32651697 ~ 32658436 (+)

Expression


Co-expression Network