G629152



Basic Information


Item Value
gene id G629152
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 58908234 ~ 58908581 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU715374
TGAGAAGAGGGTGAAGCAGGCCAGAAACAGGTTAAGTGGAGGTCTTATTCTGGGCACAGACTGAGCAGGCTGAGACAAACTCCCGGATATCTTTCTCCAGGGTGGACTACCAAAAGCGTTGATGCAGGAAGGCGAGGGTCGGTTCATACCCGGGTGACAGGTGAGATGAGTAGAATGGGCCCACTGAAGAACATCAGCGCGAACTGAATCTGGAACAAACCTGGGTCAGGCTGGTTGTGCTGAGCCTGGCAAATACGGTACTCGATCTCCCAGGAGACGGTGGCAACGATGTAAATGGATGGCACAATGGTATCTGGCTCAGAACCAGTGTTGTCGGTGGTGAACTGG

Function


NR:

description
retrotransposable element Tf2-like protein, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU715374 True 348 lncRNA 0.53 1 58908234 58908581
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528090 LOC106583075 coding downstream 12436 58890001 ~ 58895798 (-)
LOC110528983 LOC106565665 coding downstream 40018 58846467 ~ 58868216 (-)
LOC118965303 LOC106565665 coding downstream 62866 58843679 ~ 58845368 (-)
sfrs3 sfrs3 coding downstream 194604 58707572 ~ 58713630 (-)
LOC110528083 LOC106583085 coding downstream 212378 58691817 ~ 58695856 (-)
LOC110528094 LOC106583073 coding upstream 39875 58948456 ~ 58970820 (-)
eps8l3a LOC106583072 coding upstream 114113 59022694 ~ 59037726 (-)
LOC110528098 LOC106583071 coding upstream 134690 59043271 ~ 59047897 (-)
LOC110528100 mep50 coding upstream 176521 59085102 ~ 59094461 (-)
LOC110527129 LOC106583068 coding upstream 190694 59099275 ~ 59105032 (-)
G629056 LOC106583079 non-coding downstream 59811 58837838 ~ 58848423 (-)
G629124 NA non-coding downstream 84386 58821468 ~ 58823848 (-)
G629117 strip1 non-coding downstream 92169 58812794 ~ 58816065 (-)
ccnd3 LOC106583090 non-coding downstream 251044 58655809 ~ 58662211 (-)
G629185 NA non-coding upstream 15769 58924350 ~ 58924635 (-)
G629187 gnai3 non-coding upstream 17377 58925958 ~ 58932436 (-)
G629190 NA non-coding upstream 26537 58935118 ~ 58935510 (-)
G629193 NA non-coding upstream 30234 58938815 ~ 58939103 (-)
G629197 NA non-coding upstream 33363 58941944 ~ 58942164 (-)
LOC110528069 LOC106583062 other downstream 478863 58425680 ~ 58437154 (-)
G628714 NA other downstream 790112 58117190 ~ 58118122 (-)
G628575 LOC106579815 other downstream 1034903 57872050 ~ 57873331 (-)
G630132 NA other upstream 838869 59747450 ~ 59752591 (-)
G630227 NA other upstream 1007398 59915979 ~ 59917551 (-)
G630747 NA other upstream 1174465 60083046 ~ 60083857 (-)
LOC110528989 LOC106583145 other upstream 1829914 60699279 ~ 60822525 (-)
G631740 NA other upstream 2282127 61190708 ~ 61191045 (-)

Expression


G629152 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G629152 Expression in each Bioproject

Bar chart with 11 bars.
G629152 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network