G630776



Basic Information


Item Value
gene id G630776
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 60150015 ~ 60150330 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU717184
ggccaacgaccctaagcacacagtcaacacaacgcaggagtggctttgggacaagtctctgaatatccttgaggaacccagccagagcccagacttgaacccaatcgaacattcctggagagttgaaaataactgtgtagcaacgctccccatccaacctgacagagcttgagaggatctgcagagaagaatgggagaaactccccaaatacaggtgtgccaagcttgtagcgtcacacccttgtagactcaaggctgtaatcgctgccaaaggtgcttcaacaaagtactgagtaaagggtctgagtattgtatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU717184 True 316 lncRNA 0.49 1 60150015 60150330
Loading

Neighbor


gene id symbol gene type direction distance location
ruvbl1 ruvb1 coding downstream 27698 60109874 ~ 60122317 (-)
LOC110528128 LOC106583146 coding downstream 254802 59890438 ~ 59895213 (-)
LOC110528124 LOC106565535 coding downstream 420602 59726412 ~ 59729413 (-)
LOC110528120 lmbr1l coding downstream 455894 59672674 ~ 59694121 (-)
LOC110528119 rhebl1 coding downstream 478448 59667401 ~ 59671567 (-)
LOC110528140 LOC106583208 coding upstream 132314 60282644 ~ 60295290 (-)
LOC110528141 LOC106583207 coding upstream 180699 60331029 ~ 60336416 (-)
LOC110528144 LOC106583201 coding upstream 245634 60395964 ~ 60458245 (-)
si:dkey-197j19.6 LOC106583152 coding upstream 308180 60458510 ~ 60471468 (-)
LOC110528145 LOC105017320 coding upstream 328358 60478688 ~ 60487941 (-)
G630775 NA non-coding downstream 2315 60147490 ~ 60147700 (-)
G630774 NA non-coding downstream 2717 60146950 ~ 60147298 (-)
G630748 NA non-coding downstream 43878 60101948 ~ 60106137 (-)
G630718 NA non-coding downstream 85084 60062964 ~ 60064931 (-)
G630713 NA non-coding downstream 136522 60013247 ~ 60013493 (-)
G630788 NA non-coding upstream 26248 60176578 ~ 60239327 (-)
G630794 NA non-coding upstream 40997 60191327 ~ 60191837 (-)
G630886 NA non-coding upstream 219831 60370161 ~ 60370452 (-)
G630902 NA non-coding upstream 337720 60488050 ~ 60575476 (-)
LOC100136654 ip6k2 non-coding upstream 411177 60553435 ~ 60563412 (-)
G630747 NA other downstream 66158 60083046 ~ 60083857 (-)
G630227 NA other downstream 232464 59915979 ~ 59917551 (-)
G630132 NA other downstream 397424 59747450 ~ 59752591 (-)
sfrs3 sfrs3 other downstream 1436441 58707572 ~ 58713630 (-)
LOC110528083 LOC106583085 other downstream 1454248 58691817 ~ 58695856 (-)
LOC110528989 LOC106583145 other upstream 588165 60699279 ~ 60822525 (-)
G631740 NA other upstream 1040378 61190708 ~ 61191045 (-)
G631687 emc3 other upstream 1047677 61198007 ~ 61199438 (-)
G632459 NA other upstream 1540918 61691248 ~ 61691644 (-)
G632994 LOC106583176 other upstream 2070942 62221272 ~ 62222445 (-)

Expression


G630776 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G630776 Expression in each Bioproject

Bar chart with 20 bars.
G630776 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network