G630886



Basic Information


Item Value
gene id G630886
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 60370161 ~ 60370452 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU717297
gtacacttcaactgtgagagacggaatctaaaacaaaaatccagaaaatcacattgtatgatttttaagtaattaattagcattttattgcatgacataagtatttgatacatcagaaaagcagaacttaatatttggtacagaaacctttgtttacaattacagagatcatacgtttcctgtagttcttgaccaggtttgcacacactgctgcagggattttggcccactcctccatacagaccttctccagatccttcaggtttcggggctgtcgctgggcaatacggac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU717297 True 292 lncRNA 0.39 1 60370161 60370452

Neighbor


gene id symbol gene type direction distance location
LOC110528141 LOC106583207 coding downstream 33745 60331029 ~ 60336416 (-)
LOC110528140 LOC106583208 coding downstream 74871 60282644 ~ 60295290 (-)
ruvbl1 ruvb1 coding downstream 247844 60109874 ~ 60122317 (-)
LOC110528128 LOC106583146 coding downstream 474948 59890438 ~ 59895213 (-)
LOC110528124 LOC106565535 coding downstream 640748 59726412 ~ 59729413 (-)
LOC110528144 LOC106583201 coding upstream 25512 60395964 ~ 60458245 (-)
si:dkey-197j19.6 LOC106583152 coding upstream 88058 60458510 ~ 60471468 (-)
LOC110528145 LOC105017320 coding upstream 108236 60478688 ~ 60487941 (-)
uroc1 uroc1 coding upstream 120323 60490775 ~ 60500443 (-)
LOC110528150 LOC106583199 coding upstream 142120 60512572 ~ 60530678 (-)
G630788 NA non-coding downstream 130834 60176578 ~ 60239327 (-)
G630794 NA non-coding downstream 178324 60191327 ~ 60191837 (-)
G630776 NA non-coding downstream 219831 60150015 ~ 60150330 (-)
G630775 NA non-coding downstream 222461 60147490 ~ 60147700 (-)
G630774 NA non-coding downstream 222863 60146950 ~ 60147298 (-)
G630902 NA non-coding upstream 117598 60488050 ~ 60575476 (-)
LOC100136654 ip6k2 non-coding upstream 191055 60553435 ~ 60563412 (-)
LOC110528989 LOC106583145 non-coding upstream 329028 60699279 ~ 60822525 (-)
G631214 NA non-coding upstream 458934 60829386 ~ 60829648 (-)
G631238 NA non-coding upstream 476548 60847000 ~ 60847202 (-)
G630747 NA other downstream 286304 60083046 ~ 60083857 (-)
G630227 NA other downstream 452610 59915979 ~ 59917551 (-)
G630132 NA other downstream 617570 59747450 ~ 59752591 (-)
sfrs3 sfrs3 other downstream 1656587 58707572 ~ 58713630 (-)
LOC110528083 LOC106583085 other downstream 1674394 58691817 ~ 58695856 (-)
G631740 NA other upstream 820256 61190708 ~ 61191045 (-)
G631687 emc3 other upstream 827555 61198007 ~ 61199438 (-)
G632459 NA other upstream 1320796 61691248 ~ 61691644 (-)
G632994 LOC106583176 other upstream 1850820 62221272 ~ 62222445 (-)

Expression


G630886 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G630886 Expression in each Bioproject

Bar chart with 21 bars.
G630886 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network