G631253



Basic Information


Item Value
gene id G631253
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 60855431 ~ 60855779 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU717694
tgaagatacagtgccttgtgaaagtattcggcccccttgaactttgcgaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttatgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacgtttttaacaaatcaaaaactgaaaaattggccgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctctgtataaatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU717694 True 349 lncRNA 0.36 1 60855431 60855779
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528989 LOC106583145 coding downstream 32906 60699279 ~ 60822525 (-)
LOC110528152 LOC106583196 coding downstream 186347 60639865 ~ 60669084 (-)
trnaf-gaa-79 NA coding downstream 228130 60627229 ~ 60627301 (-)
LOC100136654 ip6k2 coding downstream 292019 60553435 ~ 60563412 (-)
LOC110528150 LOC106583199 coding downstream 324753 60512572 ~ 60530678 (-)
LOC110528153 LOC106583194 coding upstream 74522 60930301 ~ 60933747 (-)
LOC110528154 gnai2 coding upstream 90285 60946064 ~ 61041619 (-)
LOC110528155 LOC106583192 coding upstream 199610 61055389 ~ 61128517 (-)
LOC118965385 NA coding upstream 300939 61156718 ~ 61158861 (-)
LOC110528156 NA coding upstream 303161 61158940 ~ 61164665 (-)
G631238 NA non-coding downstream 8229 60847000 ~ 60847202 (-)
G631214 NA non-coding downstream 25783 60829386 ~ 60829648 (-)
G630902 NA non-coding downstream 279955 60488050 ~ 60575476 (-)
G631321 NA non-coding upstream 30020 60885799 ~ 60888175 (-)
G631414 NA non-coding upstream 89342 60945121 ~ 60945582 (-)
G631417 NA non-coding upstream 94950 60950729 ~ 60951670 (-)
G631462 NA non-coding upstream 193210 61048989 ~ 61049236 (-)
G631709 NA non-coding upstream 279660 61135439 ~ 61135704 (-)
G630747 NA other downstream 771574 60083046 ~ 60083857 (-)
G630227 NA other downstream 937880 59915979 ~ 59917551 (-)
G630132 NA other downstream 1102840 59747450 ~ 59752591 (-)
sfrs3 sfrs3 other downstream 2141857 58707572 ~ 58713630 (-)
G631740 NA other upstream 334929 61190708 ~ 61191045 (-)
G631687 emc3 other upstream 342228 61198007 ~ 61199438 (-)
G632459 NA other upstream 835469 61691248 ~ 61691644 (-)
G632994 LOC106583176 other upstream 1365493 62221272 ~ 62222445 (-)
LOC118965309 LOC106583169 other upstream 1652440 62506239 ~ 62520518 (-)

Expression


G631253 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G631253 Expression in each Bioproject

Bar chart with 18 bars.
G631253 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network