G631462



Basic Information


Item Value
gene id G631462
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 61048989 ~ 61049236 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU717916
cttgaaatgcttcttacgaagccactcctttgttgcccgggcggtgtgtttgggatcattgtcatgctgaaagacccagccacgtttaatcttcaatgcccttgctgatggaaagagggtttcactcaaaatctcacgatacatggccccattcattctttcctttacacgcatcagtcgtcctggtccctttgcagaaaaacagccccaaagcatgatgtttccacccccatgcttcacagtaggta

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU717916 True 248 lncRNA 0.48 1 61048989 61049236
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528154 gnai2 coding downstream 7370 60946064 ~ 61041619 (-)
LOC110528153 LOC106583194 coding downstream 115242 60930301 ~ 60933747 (-)
LOC110528989 LOC106583145 coding downstream 226464 60699279 ~ 60822525 (-)
LOC110528152 LOC106583196 coding downstream 379905 60639865 ~ 60669084 (-)
trnaf-gaa-79 NA coding downstream 421688 60627229 ~ 60627301 (-)
LOC110528155 LOC106583192 coding upstream 6153 61055389 ~ 61128517 (-)
LOC118965385 NA coding upstream 107482 61156718 ~ 61158861 (-)
LOC110528156 NA coding upstream 109704 61158940 ~ 61164665 (-)
LOC110528157 brk1 coding upstream 132029 61181265 ~ 61186850 (-)
gpx1 gpx1 coding upstream 186243 61218553 ~ 61237064 (-)
G631417 NA non-coding downstream 97319 60950729 ~ 60951670 (-)
G631414 NA non-coding downstream 103407 60945121 ~ 60945582 (-)
G631321 NA non-coding downstream 160814 60885799 ~ 60888175 (-)
G631253 NA non-coding downstream 193210 60855431 ~ 60855779 (-)
G631238 NA non-coding downstream 201787 60847000 ~ 60847202 (-)
G631709 NA non-coding upstream 86203 61135439 ~ 61135704 (-)
G631710 NA non-coding upstream 88973 61138209 ~ 61138512 (-)
G631721 NA non-coding upstream 110743 61159979 ~ 61160196 (-)
G631725 NA non-coding upstream 119428 61168664 ~ 61168974 (-)
G631727 NA non-coding upstream 122593 61171829 ~ 61172050 (-)
G630747 NA other downstream 965132 60083046 ~ 60083857 (-)
G630227 NA other downstream 1131438 59915979 ~ 59917551 (-)
G630132 NA other downstream 1296398 59747450 ~ 59752591 (-)
sfrs3 sfrs3 other downstream 2335415 58707572 ~ 58713630 (-)
G631740 NA other upstream 141472 61190708 ~ 61191045 (-)
G631687 emc3 other upstream 148771 61198007 ~ 61199438 (-)
G632459 NA other upstream 642012 61691248 ~ 61691644 (-)
G632994 LOC106583176 other upstream 1172036 62221272 ~ 62222445 (-)
LOC118965309 LOC106583169 other upstream 1458983 62506239 ~ 62520518 (-)

Expression


G631462 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G631462 Expression in each Bioproject

Bar chart with 16 bars.
G631462 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network