G631732



Basic Information


Item Value
gene id G631732
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 61175822 ~ 61176087 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU718205
actgctcaaaaaaataaagggaacacttaaacaacacaatgtaactccaagtcaatcacacttctgtgctttcactctagtggtatgagacggagtctacaacccacacaagtggctcaggtagtgcatctcatccaggatggcacatcaatgcgagctgtggcaagaaggtttgctgtgtctgtcagcatagtgtccagagcatggaggcgctaccaggagacaggccagtacatcaggagacgtggaggaggccgtaggagggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU718205 True 266 lncRNA 0.50 1 61175822 61176087
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528156 NA coding downstream 11157 61158940 ~ 61164665 (-)
LOC118965385 NA coding downstream 16961 61156718 ~ 61158861 (-)
LOC110528155 LOC106583192 coding downstream 47305 61055389 ~ 61128517 (-)
LOC110528154 gnai2 coding downstream 134203 60946064 ~ 61041619 (-)
LOC110528153 LOC106583194 coding downstream 242075 60930301 ~ 60933747 (-)
LOC110528157 brk1 coding upstream 5178 61181265 ~ 61186850 (-)
gpx1 gpx1 coding upstream 59392 61218553 ~ 61237064 (-)
LOC110528164 LOC106583182 coding upstream 365916 61542003 ~ 61557188 (-)
LOC110528165 LOC106583181 coding upstream 458110 61634197 ~ 61749981 (-)
LOC110528991 LOC106583180 coding upstream 624591 61800678 ~ 61921139 (-)
G631731 LOC106581475 non-coding downstream 483 61175088 ~ 61175339 (-)
G631730 NA non-coding downstream 820 61174521 ~ 61175002 (-)
G631727 NA non-coding downstream 3772 61171829 ~ 61172050 (-)
G631725 NA non-coding downstream 6848 61168664 ~ 61168974 (-)
G631721 NA non-coding downstream 15626 61159979 ~ 61160196 (-)
G631685 NA non-coding upstream 23495 61199582 ~ 61200452 (-)
G631743 LOC106583188 non-coding upstream 47494 61223581 ~ 61224806 (-)
G631863 NA non-coding upstream 198633 61374720 ~ 61378603 (-)
LOC110528989 LOC106583145 other downstream 427723 60699279 ~ 60822525 (-)
G630747 NA other downstream 1091965 60083046 ~ 60083857 (-)
G630227 NA other downstream 1258271 59915979 ~ 59917551 (-)
G630132 NA other downstream 1423231 59747450 ~ 59752591 (-)
sfrs3 sfrs3 other downstream 2462248 58707572 ~ 58713630 (-)
G631740 NA other upstream 14621 61190708 ~ 61191045 (-)
G631687 emc3 other upstream 21920 61198007 ~ 61199438 (-)
G632459 NA other upstream 515161 61691248 ~ 61691644 (-)
G632994 LOC106583176 other upstream 1045185 62221272 ~ 62222445 (-)
LOC118965309 LOC106583169 other upstream 1332132 62506239 ~ 62520518 (-)

Expression


G631732 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G631732 Expression in each Bioproject

Bar chart with 15 bars.
G631732 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network