G632459



Basic Information


Item Value
gene id G632459
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 61691248 ~ 61691644 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU718974
acagcccttggttcaccccagacctgactgccctcgaccagcacaaaaacatcctgtggcggactgcaatagcatcgaatagtccccgtgatatgcaactgttcagggaagtccggaaccaatacatgcagtcagtcaggaaagttaaggccagcttcttcaggcagaagtttgcatcctgtagctccaactccaaaaagttctgggacactgtgaagtcaatggagaacaagagcacctcctcccagctgcccactgcactgaggctaggtaacacggtcaccaccgataaatccatgattatcgaaaacttcaataagcatttctcaacggctggccatgccttccgcctggctacttcaacctcggccaacagccccgccccccccgctgctcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU718974 True 397 TUCP 0.53 1 61691248 61691644

Neighbor


gene id symbol gene type direction distance location
LOC110528164 LOC106583182 coding downstream 134060 61542003 ~ 61557188 (-)
gpx1 gpx1 coding downstream 454253 61218553 ~ 61237064 (-)
LOC110528157 brk1 coding downstream 504398 61181265 ~ 61186850 (-)
LOC110528156 NA coding downstream 526583 61158940 ~ 61164665 (-)
LOC118965385 NA coding downstream 532387 61156718 ~ 61158861 (-)
LOC110528991 LOC106583180 coding upstream 109034 61800678 ~ 61921139 (-)
LOC110528169 LOC106583177 coding upstream 468331 62159975 ~ 62175491 (-)
LOC110528170 LOC106565587 coding upstream 484337 62175981 ~ 62185946 (-)
LOC110527134 LOC106583149 coding upstream 653438 62345082 ~ 62347315 (-)
LOC110528993 NA coding upstream 657458 62349102 ~ 62349904 (-)
G632453 NA non-coding downstream 29225 61661819 ~ 61662023 (-)
G632450 NA non-coding downstream 32562 61658424 ~ 61658686 (-)
G632427 NA non-coding downstream 57685 61632680 ~ 61633563 (-)
G632423 NA non-coding downstream 66907 61624037 ~ 61624341 (-)
G632460 NA non-coding upstream 1172 61692816 ~ 61693145 (-)
G632475 NA non-coding upstream 24897 61716541 ~ 61716883 (-)
G632476 NA non-coding upstream 25720 61717364 ~ 61717841 (-)
G632483 NA non-coding upstream 51666 61743310 ~ 61758965 (-)
G631687 emc3 other downstream 491810 61198007 ~ 61199438 (-)
G631740 NA other downstream 500203 61190708 ~ 61191045 (-)
LOC110528989 LOC106583145 other downstream 943149 60699279 ~ 60822525 (-)
G630747 NA other downstream 1607391 60083046 ~ 60083857 (-)
G630227 NA other downstream 1773697 59915979 ~ 59917551 (-)
G632994 LOC106583176 other upstream 529628 62221272 ~ 62222445 (-)
LOC118965309 LOC106583169 other upstream 816575 62506239 ~ 62520518 (-)
si:dkey-28n18.9 LOC106583160 other upstream 1315131 62983119 ~ 63008072 (-)
LOC110528212 LOC106583293 other upstream 2094128 63785772 ~ 63827547 (-)
LOC110528216 LOC106565449 other upstream 2302872 63993536 ~ 64036771 (-)

Expression


G632459 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G632459 Expression in each Bioproject

Bar chart with 19 bars.
G632459 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network