G632460



Basic Information


Item Value
gene id G632460
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 61692816 ~ 61693145 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU718975
ctcttggctacatagctgatgcacgctggactgtccattaatcacggtactccattctgcttgtttgttttatctgttggccccgttgcctagtcaacgccattttacctgctgttgttgtgctagctgattagctgttgtctcacctactgttttagctagctttcccaactcaacacctgtgattactgtatgcctcgctgtatgtctctctcaagtgtcaatatgccttgtatactgttgttcaggttagttatcattgttttagttcacaatggagcccctagctccactcttcatacccctgataactcctttgtcccacctccc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU718975 True 330 lncRNA 0.45 1 61692816 61693145

Neighbor


gene id symbol gene type direction distance location
LOC110528164 LOC106583182 coding downstream 135628 61542003 ~ 61557188 (-)
gpx1 gpx1 coding downstream 455821 61218553 ~ 61237064 (-)
LOC110528157 brk1 coding downstream 505966 61181265 ~ 61186850 (-)
LOC110528156 NA coding downstream 528151 61158940 ~ 61164665 (-)
LOC118965385 NA coding downstream 533955 61156718 ~ 61158861 (-)
LOC110528991 LOC106583180 coding upstream 107533 61800678 ~ 61921139 (-)
LOC110528169 LOC106583177 coding upstream 466830 62159975 ~ 62175491 (-)
LOC110528170 LOC106565587 coding upstream 482836 62175981 ~ 62185946 (-)
LOC110527134 LOC106583149 coding upstream 651937 62345082 ~ 62347315 (-)
LOC110528993 NA coding upstream 655957 62349102 ~ 62349904 (-)
G632453 NA non-coding downstream 30793 61661819 ~ 61662023 (-)
G632450 NA non-coding downstream 34130 61658424 ~ 61658686 (-)
G632427 NA non-coding downstream 59253 61632680 ~ 61633563 (-)
G632423 NA non-coding downstream 68475 61624037 ~ 61624341 (-)
G632475 NA non-coding upstream 23396 61716541 ~ 61716883 (-)
G632476 NA non-coding upstream 24219 61717364 ~ 61717841 (-)
G632483 NA non-coding upstream 50165 61743310 ~ 61758965 (-)
G632544 NA non-coding upstream 153457 61846602 ~ 61847677 (-)
G632459 NA other downstream 1172 61691248 ~ 61691644 (-)
G631687 emc3 other downstream 493378 61198007 ~ 61199438 (-)
G631740 NA other downstream 501771 61190708 ~ 61191045 (-)
LOC110528989 LOC106583145 other downstream 944717 60699279 ~ 60822525 (-)
G630747 NA other downstream 1608959 60083046 ~ 60083857 (-)
G632994 LOC106583176 other upstream 528127 62221272 ~ 62222445 (-)
LOC118965309 LOC106583169 other upstream 815074 62506239 ~ 62520518 (-)
si:dkey-28n18.9 LOC106583160 other upstream 1313630 62983119 ~ 63008072 (-)
LOC110528212 LOC106583293 other upstream 2092627 63785772 ~ 63827547 (-)
LOC110528216 LOC106565449 other upstream 2301371 63993536 ~ 64036771 (-)

Expression


G632460 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G632460 Expression in each Bioproject

Bar chart with 18 bars.
G632460 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network