G632776



Basic Information


Item Value
gene id G632776
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 62139516 ~ 62139991 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU719313
ttgttactctaacttccgcgacgcatataaggccctgccccgcccccctttcggaaaagctgaccacgactccattttgttgatccctgcctacagacagaaactaaaacaagaggctcccacgctgaggtctgtccaacgctggtccgaccaagctgactccacactccaagactgcttccatcacgtggactgggagatgtttcgtattgcgtcagataacaacattgacgaatacgctgattcggtgtgtgagttcattagaacttgcgttgaagatgtcgttcccatagcaacgattaaaacattccctaaccagaaaccgtggattgatggcagcattcgtgtgaaactgaaagcgcgaaccactgcttttaatcagggcaaggtgtctggtaacatgaccgaatacaaacagtgcagctattccctccgcaaggctatcaaacaagctaagcgccagtacagagacaaag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU719313 True 476 TUCP 0.49 1 62139516 62139991
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528168 LOC106583178 coding upstream 3931 62024859 ~ 62135585 (+)
LOC110528167 LOC106583179 coding upstream 126181 62001553 ~ 62013335 (+)
LOC110528992 NA coding upstream 143218 61971954 ~ 61996298 (+)
LOC110528166 NA coding upstream 432190 61699972 ~ 61707326 (+)
LOC110528162 LOC106583183 coding upstream 599797 61533947 ~ 61539719 (+)
LOC110528171 LOC106583176 coding downstream 54664 62194655 ~ 62228018 (+)
LOC110528172 LOC106583174 coding downstream 91730 62231721 ~ 62238483 (+)
LOC110528174 LOC106583173 coding downstream 101994 62241985 ~ 62319111 (+)
LOC110528175 LOC105017014 coding downstream 185438 62325429 ~ 62342019 (+)
LOC110528177 LOC106583170 coding downstream 226950 62366941 ~ 62482607 (+)
G632758 NA non-coding upstream 31042 62107342 ~ 62108474 (+)
G632752 NA non-coding upstream 40255 62095087 ~ 62099261 (+)
G632724 NA non-coding upstream 84284 62053802 ~ 62055232 (+)
G632706 NA non-coding upstream 86115 62051961 ~ 62053401 (+)
G632715 NA non-coding upstream 94951 62041810 ~ 62044565 (+)
G632796 NA non-coding downstream 37549 62177540 ~ 62177761 (+)
G632780 NA non-coding downstream 78504 62218495 ~ 62218746 (+)
G632823 NA non-coding downstream 113098 62253089 ~ 62255650 (+)
G632824 NA non-coding downstream 113704 62253695 ~ 62256246 (+)
G632146 NA other upstream 447869 61691281 ~ 61691647 (+)
LOC110528160 LOC106583186 other upstream 692769 61385568 ~ 61470736 (+)
G631568 gpx1 other upstream 888260 61235478 ~ 61251702 (+)
G630515 uroc1 other upstream 1643087 60492277 ~ 60496429 (+)
G630516 NA other upstream 1656459 60468931 ~ 60483057 (+)
G632809 LOC100194703 other downstream 90524 62230515 ~ 62231349 (+)
G632817 NA other downstream 105929 62245920 ~ 62329061 (+)
G633613 NA other downstream 789407 62929398 ~ 62929699 (+)
LOC110528206 hoxc6 other downstream 1480362 63619980 ~ 63622602 (+)

Expression


G632776 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G632776 Expression in each Bioproject

Bar chart with 18 bars.
G632776 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network