G634016



Basic Information


Item Value
gene id G634016
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 63180541 ~ 63180858 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU720724
gtgcgggctattccacctcgccgcactggcctggctaccgggagcattcaaccaggtaaggttgggcaggctcggtgctcaagagctccagtgcgcctgcacggtccggtctatccagtgccacctccacgcaccagccctccggtggcagccccccgcaccaggctgtctctccgtctcatccctacaggtgctcccgcctgtccagcgctgccagagccttcctcctgcccagcgctgctagagtctcccgtctgtcctgagctgctagagtctcccgtctgtcctgagctgctagagtctcccgtctgtcctgag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU720724 True 318 lncRNA 0.65 1 63180541 63180858
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528193 dtx3l coding upstream 52510 63118564 ~ 63128031 (+)
LOC110528191 LOC106565469 coding upstream 68768 63015402 ~ 63111773 (+)
LOC118965311 NA coding upstream 167983 62988481 ~ 63012558 (+)
LOC110528188 LOC106583159 coding upstream 168702 63008145 ~ 63011839 (+)
LOC118965310 NA coding upstream 298600 62879135 ~ 62881941 (+)
LOC110528194 LOC106583304 coding downstream 42960 63223818 ~ 63288934 (+)
LOC110528197 LOC106583300 coding downstream 191090 63371948 ~ 63446380 (+)
LOC110527135 hoxc13 coding downstream 358032 63538890 ~ 63544471 (+)
LOC110528199 hoxc12 coding downstream 373199 63554057 ~ 63558322 (+)
LOC110528202 hoxc11 coding downstream 388945 63569803 ~ 63573270 (+)
G634011 NA non-coding upstream 4837 63174695 ~ 63175704 (+)
G634004 NA non-coding upstream 12540 63167794 ~ 63168001 (+)
G634002 NA non-coding upstream 13058 63167097 ~ 63167483 (+)
G633708 NA non-coding upstream 42226 63138011 ~ 63138315 (+)
G633700 NA non-coding upstream 50962 63128804 ~ 63129579 (+)
G634018 NA non-coding downstream 1401 63182259 ~ 63182483 (+)
G634039 NA non-coding downstream 10487 63191345 ~ 63191552 (+)
G634044 NA non-coding downstream 14498 63195356 ~ 63195588 (+)
G634102 NA non-coding downstream 115864 63296722 ~ 63297238 (+)
G634126 NA non-coding downstream 154815 63335673 ~ 63336103 (+)
G633613 NA other upstream 250842 62929398 ~ 62929699 (+)
LOC110528175 LOC105017014 other upstream 838576 62325429 ~ 62342019 (+)
G632817 NA other upstream 851480 62245920 ~ 62329061 (+)
G632809 LOC100194703 other upstream 949192 62230515 ~ 62231349 (+)
G632776 NA other upstream 1040550 62139516 ~ 62139991 (+)
LOC110528206 hoxc6 other downstream 439495 63619980 ~ 63622602 (+)
LOC110528222 LOC106583247 other downstream 1015183 64099788 ~ 64201232 (+)
G635332 LOC100380681 other downstream 1137342 64318200 ~ 64326259 (+)
G635635 NA other downstream 1604358 64785216 ~ 64786393 (+)
G635769 NA other downstream 1870786 65051644 ~ 65052156 (+)

Expression


G634016 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G634016 Expression in each Bioproject

Bar chart with 20 bars.
G634016 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network