G634962



Basic Information


Item Value
gene id G634962
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 63627102 ~ 63627463 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU721768
ACAAGGTGAGCAATTTAAAATATAGGCTCTACCATGGTGCTAACTGTTCTAGATGAATTAATAGGCCATTAAATAATTCCAGTGCATTTTGTTCCAGAGGATCAACCCCCATTCTACCACTGAATAGATTTCCACAAAGTGAAACAGGGATTTGACAAGAACATGTGAACTGTAATATGTGAAATCGTTTTACCTACAAGGCCTTCAACGTTTTCTTTGTGAGCAATTATAACCCTGCAGAGTATGAGAAAAGGTTGACATAACACTGTTTTGTGGCAGACGTTGGAAATGAGGGTGAGAAGGAAATTGTTTAATTGTTAGCTACTCATTGTGGACATGAGCTACTCATTGTGGACATGAGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU721768 True 362 lncRNA 0.38 1 63627102 63627463
Loading

Neighbor


gene id symbol gene type direction distance location
calcoco1b calcoco1 coding downstream 89518 63464383 ~ 63537584 (-)
nr1d4b LOC106583303 coding downstream 294610 63319140 ~ 63332492 (-)
LOC110528195 LOC106565465 coding downstream 329760 63290827 ~ 63297342 (-)
LOC110528994 LOC106583141 coding downstream 484602 63128190 ~ 63142500 (-)
si:dkey-28n18.9 LOC106583160 coding downstream 619030 62983119 ~ 63008072 (-)
trnar-ucu NA coding upstream 39764 63667227 ~ 63667316 (-)
smug1 smug1 coding upstream 54812 63682275 ~ 63685137 (-)
LOC110528212 LOC106583293 coding upstream 158314 63785772 ~ 63827547 (-)
LOC110528215 LOC106583288 coding upstream 273474 63900937 ~ 63962763 (-)
LOC110528216 LOC106565449 coding upstream 366073 63993536 ~ 64036771 (-)
G634955 NA non-coding downstream 13337 63613524 ~ 63613765 (-)
G634951 NA non-coding downstream 16510 63610347 ~ 63610592 (-)
G634949 NA non-coding downstream 18229 63608648 ~ 63608873 (-)
G634924 NA non-coding downstream 20790 63604631 ~ 63606312 (-)
G634945 NA non-coding downstream 30819 63596070 ~ 63596283 (-)
G635079 NA non-coding upstream 209601 63837064 ~ 63837302 (-)
G635080 NA non-coding upstream 210494 63837957 ~ 63838183 (-)
G635082 NA non-coding upstream 212281 63839744 ~ 63839951 (-)
G635084 NA non-coding upstream 214867 63842330 ~ 63842553 (-)
LOC118965309 LOC106583169 other downstream 1106592 62506239 ~ 62520518 (-)
G632994 LOC106583176 other downstream 1405052 62221272 ~ 62222445 (-)
G632459 NA other downstream 1935458 61691248 ~ 61691644 (-)
G631687 emc3 other downstream 2427664 61198007 ~ 61199438 (-)
G635167 NA other upstream 404983 64032446 ~ 64035381 (-)
G636055 LOC100380681 other upstream 690731 64318194 ~ 64326230 (-)
LOC110528235 LOC106583273 other upstream 895051 64521769 ~ 64526166 (-)

Expression


G634962 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G634962 Expression in each Bioproject

Bar chart with 7 bars.
G634962 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 7.
End of interactive chart.

Co-expression Network