G635684



Basic Information


Item Value
gene id G635684
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 64939862 ~ 64940110 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU722596
tggaggaaacctggcaccatcactatggtgaagcatggtggtggcagcatcatgctgtggggatgtttttcagcggcagggactgggagactagtcaggatcgaggcaaagatgaacagtgcaaagtacagaaagatccttgatgaaatcctgctccagagcgctcaggacctcagactggggagaaggttcaccttccaacaggacaacaacactaagcacacagccaagacaatgcaggagtggctt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU722596 True 249 lncRNA 0.52 1 64939862 64940110

Neighbor


gene id symbol gene type direction distance location
ctsz LOC106583261 coding upstream 81248 64843280 ~ 64858614 (+)
npepl1 npepl1 coding upstream 96866 64833274 ~ 64842996 (+)
LOC110528243 stx16 coding upstream 108827 64815994 ~ 64831035 (+)
LOC110528241 LOC106583266 coding upstream 191589 64745278 ~ 64748273 (+)
LOC110528238 LOC106583272 coding upstream 284112 64652754 ~ 64655750 (+)
LOC110528999 olfml3 coding downstream 44509 64984619 ~ 64987080 (+)
LOC110528254 LOC106583349 coding downstream 137787 65077897 ~ 65081518 (+)
LOC110528253 LOC106583348 coding downstream 141959 65082069 ~ 65097635 (+)
LOC110528255 LOC106583345 coding downstream 175813 65115923 ~ 65160135 (+)
LOC110528256 LOC106583346 coding downstream 224757 65164867 ~ 65178307 (+)
G635683 NA non-coding upstream 35 64939612 ~ 64939827 (+)
G635670 NA non-coding upstream 15886 64923667 ~ 64923976 (+)
G635666 NA non-coding upstream 20444 64918872 ~ 64919418 (+)
G635641 NA non-coding upstream 142220 64796946 ~ 64797642 (+)
G635637 NA non-coding upstream 148182 64791359 ~ 64791680 (+)
G635738 NA non-coding downstream 64709 65004819 ~ 65028683 (+)
G635752 NA non-coding downstream 88941 65029051 ~ 65029266 (+)
G635754 NA non-coding downstream 98491 65038601 ~ 65039018 (+)
G635756 NA non-coding downstream 100018 65040128 ~ 65040389 (+)
G635757 NA non-coding downstream 101661 65041771 ~ 65042546 (+)
G635635 NA other upstream 153469 64785216 ~ 64786393 (+)
G635332 LOC100380681 other upstream 613603 64318200 ~ 64326259 (+)
LOC110528222 LOC106583247 other upstream 738630 64099788 ~ 64201232 (+)
LOC110528206 hoxc6 other upstream 1318331 63619980 ~ 63622602 (+)
G633613 NA other upstream 2010163 62929398 ~ 62929699 (+)
G635769 NA other downstream 111534 65051644 ~ 65052156 (+)
G635848 NA other downstream 389826 65329936 ~ 65330292 (+)
LOC110528281 LOC106565490 other downstream 964035 65901905 ~ 65908098 (+)
G637929 NA other downstream 1612478 66552588 ~ 66607744 (+)
G638011 NA other downstream 1681576 66621686 ~ 66622094 (+)

Expression


G635684 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G635684 Expression in each Bioproject

Bar chart with 21 bars.
G635684 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network