G635848



Basic Information


Item Value
gene id G635848
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 65329936 ~ 65330292 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU722781
tttttctgcaaagggaccaggacgactgatccgtgtaaaggaaagaatgaatggggccatgtatcgtgagatttttagtgaaaacctccttccatcagcaagtgcattgaagatgaaacgtggctgggtctttcagcatgactattatcccaaacacaccgcccgggcaacaaaggagtggcttcgtaagaagcatttcaaggtcctggagtggcctagccagtctccagatctcaaccccatagaaaatctttggagggagttgaaagtccgtgttgcccagcaacagccccaaaacatcactgctctagaggagatctgcatggaggaatgggccaaaataccagcaacagtgtg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU722781 True 357 TUCP 0.48 1 65329936 65330292

Neighbor


gene id symbol gene type direction distance location
sys1 sys1 coding upstream 1594 65326359 ~ 65328342 (+)
LOC110528262 LOC106583338 coding upstream 21600 65292812 ~ 65308336 (+)
zgc:113184 LOC106583340 coding upstream 49520 65277220 ~ 65280416 (+)
LOC110528259 LOC106583342 coding upstream 55916 65246585 ~ 65274020 (+)
LOC110528258 LOC106583344 coding upstream 93012 65229197 ~ 65236924 (+)
LOC110528267 LOC106583332 coding downstream 37297 65367589 ~ 65388465 (+)
LOC110528266 LOC106583331 coding downstream 59062 65389354 ~ 65430309 (+)
LOC110528268 tbc1d20 coding downstream 107473 65437765 ~ 65447183 (+)
maf1a LOC106583327 coding downstream 129139 65459431 ~ 65466804 (+)
LOC110529001 NA coding downstream 284260 65614552 ~ 65614997 (+)
G635764 NA non-coding upstream 169365 65160271 ~ 65160571 (+)
LOC110528255 LOC106583345 non-coding upstream 169801 65115923 ~ 65160135 (+)
G635810 NA non-coding upstream 207598 65121936 ~ 65122338 (+)
G635800 NA non-coding upstream 225925 65103745 ~ 65104011 (+)
G635799 NA non-coding upstream 226891 65102665 ~ 65103045 (+)
G635846 NA non-coding downstream 224 65330516 ~ 65330883 (+)
G635912 NA non-coding downstream 6369 65336661 ~ 65337004 (+)
G635841 LOC106583334 non-coding downstream 6824 65337116 ~ 65337624 (+)
G635913 NA non-coding downstream 8517 65338809 ~ 65339031 (+)
G635921 NA non-coding downstream 35800 65366092 ~ 65366291 (+)
G635769 NA other upstream 277780 65051644 ~ 65052156 (+)
G635635 NA other upstream 543543 64785216 ~ 64786393 (+)
G635332 LOC100380681 other upstream 1003677 64318200 ~ 64326259 (+)
LOC110528222 LOC106583247 other upstream 1128704 64099788 ~ 64201232 (+)
LOC110528206 hoxc6 other upstream 1708405 63619980 ~ 63622602 (+)
LOC110528281 LOC106565490 other downstream 573853 65901905 ~ 65908098 (+)
G637929 NA other downstream 1222296 66552588 ~ 66607744 (+)
G638011 NA other downstream 1291394 66621686 ~ 66622094 (+)
patz1 LOC106583552 other downstream 2110240 67433792 ~ 67446077 (+)
G639648 NA other downstream 2883226 68213518 ~ 68214402 (+)

Expression


G635848 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G635848 Expression in each Bioproject

Bar chart with 20 bars.
G635848 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network