G636707



Basic Information


Item Value
gene id G636707
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 65448080 ~ 65448312 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU723756
CATGCACTGATGTCAAGGGATGATTTGTGTAAAATTGTGCACATAACTTGTTAGGATTCTGTTCAGTTCTTTGTGAAGACACTGGCTGGTCTTACTTCCAAAGGAACTTTATATTCATTTTATGTTGGAACTTTGAACACCATTGAGTGTCTGATGATTCCCGATATGAGAATAACATAACGGAATAACATTATCCTGGTGTTTAATTGAGAGTTCAAAGGACATTGCTATAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU723756 True 233 lncRNA 0.36 1 65448080 65448312

Neighbor


gene id symbol gene type direction distance location
LOC110529000 NA coding downstream 85581 65360070 ~ 65362499 (-)
LOC100136780 ssr1 coding downstream 100812 65344022 ~ 65347268 (-)
LOC110528265 LOC106583334 coding downstream 105314 65337198 ~ 65342766 (-)
LOC110528264 pol3 coding downstream 120984 65325140 ~ 65327096 (-)
LOC110528263 LOC106583335 coding downstream 124773 65308248 ~ 65323307 (-)
LOC118965360 rbck1 coding upstream 2861 65451173 ~ 65457260 (-)
LOC110528269 trib3 coding upstream 19424 65467736 ~ 65478313 (-)
sox12 sox12 coding upstream 138287 65586599 ~ 65593329 (-)
LOC118965313 NA coding upstream 233139 65681451 ~ 65687986 (-)
LOC110528276 LOC106583323 coding upstream 271742 65720054 ~ 65744788 (-)
G636706 NA non-coding downstream 460 65447412 ~ 65447620 (-)
G636704 NA non-coding downstream 11432 65436366 ~ 65436648 (-)
G636703 NA non-coding downstream 14145 65433725 ~ 65433935 (-)
G636661 NA non-coding downstream 82379 65365464 ~ 65365701 (-)
G636659 NA non-coding downstream 83655 65364221 ~ 65364425 (-)
G636720 NA non-coding upstream 47896 65496208 ~ 65496582 (-)
G636721 NA non-coding upstream 50396 65498708 ~ 65513913 (-)
G636722 NA non-coding upstream 50905 65499217 ~ 65578389 (-)
G637403 NA non-coding upstream 256708 65705020 ~ 65705229 (-)
G636571 LOC106583344 other downstream 211199 65209760 ~ 65236881 (-)
G636533 LOC106583345 other downstream 312285 65135538 ~ 65135795 (-)
G636532 LOC106583345 other downstream 313335 65134250 ~ 65134745 (-)
LOC110528239 LOC106583268 other downstream 776064 64669731 ~ 64689634 (-)
LOC110528235 LOC106583273 other downstream 923899 64521769 ~ 64526166 (-)
G636719 NA other upstream 45478 65493790 ~ 65495157 (-)
G637495 NA other upstream 432700 65881012 ~ 65882556 (-)
G637504 LOC106583318 other upstream 438624 65886936 ~ 65892402 (-)
G637669 NA other upstream 727648 66175960 ~ 66177895 (-)
G637722 NA other upstream 828470 66276782 ~ 66277080 (-)

Expression


G636707 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G636707 Expression in each Bioproject

Bar chart with 7 bars.
G636707 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network