G637412



Basic Information


Item Value
gene id G637412
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 65716216 ~ 65716442 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU724519
CCGTGTTGGGCTGTGGAGGTTGTTGCGGTGCCACAGTAGCGGTGCCCGCTCAGCAGACGAACCGGTGTTAGCAGGACGCTGTGTCGTCATGAAGCTGCCGGACTTCACCATGACGCAAAAGCTGGGGGTGCTGAGGCAGAGTGCTGCCGCTGTACTCCTCCTGCTCCCCAAAAAACATGTCCTCCATCCCCCAGGATATCATACAGGTAGGTTAGACTTTATTTCAG

Function


NR:

description
PREDICTED: nicalin-1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU724519 True 227 lncRNA 0.57 1 65716216 65716442
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965313 NA coding downstream 28230 65681451 ~ 65687986 (-)
sox12 sox12 coding downstream 122887 65586599 ~ 65593329 (-)
LOC110528269 trib3 coding downstream 237903 65467736 ~ 65478313 (-)
LOC118965360 rbck1 coding downstream 258956 65451173 ~ 65457260 (-)
LOC110529000 NA coding downstream 353717 65360070 ~ 65362499 (-)
LOC110528276 LOC106583323 coding upstream 3612 65720054 ~ 65744788 (-)
LOC110528277 NA coding upstream 70499 65785569 ~ 65796175 (-)
LOC110528278 LOC106583321 coding upstream 94999 65811441 ~ 65857952 (-)
LOC110528280 un119 coding upstream 151051 65867493 ~ 65871588 (-)
LOC110528283 tctn1 coding upstream 212738 65929180 ~ 65942126 (-)
G637403 NA non-coding downstream 10987 65705020 ~ 65705229 (-)
G636722 NA non-coding downstream 137827 65499217 ~ 65578389 (-)
G636721 NA non-coding downstream 202303 65498708 ~ 65513913 (-)
G636720 NA non-coding downstream 219634 65496208 ~ 65496582 (-)
G637424 NA non-coding upstream 18570 65735012 ~ 65735349 (-)
G637441 NA non-coding upstream 43031 65759473 ~ 65759694 (-)
G637452 NA non-coding upstream 57267 65773709 ~ 65774110 (-)
G637454 NA non-coding upstream 59746 65776188 ~ 65776425 (-)
G636719 NA other downstream 221059 65493790 ~ 65495157 (-)
G636571 LOC106583344 other downstream 479335 65209760 ~ 65236881 (-)
G636533 LOC106583345 other downstream 580421 65135538 ~ 65135795 (-)
G636532 LOC106583345 other downstream 581471 65134250 ~ 65134745 (-)
LOC110528239 LOC106583268 other downstream 1044200 64669731 ~ 64689634 (-)
G637495 NA other upstream 164570 65881012 ~ 65882556 (-)
G637504 LOC106583318 other upstream 170494 65886936 ~ 65892402 (-)
G637669 NA other upstream 459518 66175960 ~ 66177895 (-)
G637722 NA other upstream 560340 66276782 ~ 66277080 (-)
LOC110528300 LOC106583565 other upstream 1339212 67055190 ~ 67079126 (-)

Expression


G637412 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G637412 Expression in each Bioproject

Bar chart with 4 bars.
G637412 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.

Co-expression Network