G637929



Basic Information


Item Value
gene id G637929
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 66552588 ~ 66607744 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU725095
cacgtttcttgttttcgttagtttgttcatgtatagtgtcttcattaaaatacaatgaacaaccaccacgctgcgctttggtccgcttctcctcctcctacagacgaacgcccttacagaatcacccaccacaacaggaccaagcggtgtggtaatgggcaaaggaaaaagcagcagcaggagcagcgcgaggaggtatggacatgggaggacgaattagacggtaaaggaccttgggctcagccaggagagtatcgccgccccaaggaagaacgggaggcggcgaaagcggagaggcgctggtatgaggaggcagcgcggcgtcgtggatggaagcccgggagtcagccccaaaaatttcttgggggggggctaacagggagtatggctacgccaggtaggagacctgagccaacttcctgtggttaccggtgggctagagagacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU725095 True 447 TUCP 0.56 2 66552588 66607744

Neighbor


gene id symbol gene type direction distance location
myorg kiaa1161 coding upstream 233381 66311011 ~ 66319207 (+)
LOC110528296 ccdc63 coding upstream 338955 66204437 ~ 66213633 (+)
LOC110528290 LOC106583572 coding upstream 438030 66049287 ~ 66114558 (+)
tacc1 LOC106586881 coding upstream 513628 66002466 ~ 66038960 (+)
ddhd2 LOC106583313 coding upstream 560728 65983543 ~ 65991860 (+)
LOC110529005 LOC106583566 coding downstream 323294 66931038 ~ 67049072 (+)
LOC110528302 LOC106583563 coding downstream 494358 67102102 ~ 67112227 (+)
LOC110528303 LOC106583562 coding downstream 514447 67122191 ~ 67130475 (+)
LOC110528306 LOC106583560 coding downstream 580132 67187876 ~ 67201857 (+)
LOC110528310 LOC106583556 coding downstream 742145 67349886 ~ 67352106 (+)
G637901 NA non-coding upstream 23982 66528403 ~ 66528606 (+)
G637299 NA non-coding upstream 120498 66420504 ~ 66432090 (+)
G637246 NA non-coding upstream 151248 66338641 ~ 66401340 (+)
G637208 NA non-coding upstream 272531 66279390 ~ 66280057 (+)
G637158 NA non-coding upstream 327025 66223629 ~ 66225563 (+)
G637998 NA non-coding downstream 4266 66612010 ~ 66612214 (+)
G638005 NA non-coding downstream 9790 66617534 ~ 66617746 (+)
G638006 NA non-coding downstream 11059 66618803 ~ 66619003 (+)
G638028 NA non-coding downstream 27112 66634856 ~ 66635635 (+)
G638051 NA non-coding downstream 43364 66651108 ~ 66651316 (+)
LOC110528281 LOC106565490 other upstream 644769 65901905 ~ 65908098 (+)
G635848 NA other upstream 1222296 65329936 ~ 65330292 (+)
G635769 NA other upstream 1500432 65051644 ~ 65052156 (+)
G635635 NA other upstream 1766195 64785216 ~ 64786393 (+)
G635332 LOC100380681 other upstream 2226329 64318200 ~ 64326259 (+)
G638011 NA other downstream 13942 66621686 ~ 66622094 (+)
patz1 LOC106583552 other downstream 832788 67433792 ~ 67446077 (+)
G639648 NA other downstream 1605774 68213518 ~ 68214402 (+)
LOC110528344 LOC106583528 other downstream 2146319 68568757 ~ 68790841 (+)
G640523 NA other downstream 2313882 68921626 ~ 68927219 (+)

Expression


G637929 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G637929 Expression in each Bioproject

Bar chart with 19 bars.
G637929 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network