G638023



Basic Information


Item Value
gene id G638023
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 66631747 ~ 66632029 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU725192
gtacagagacctttgtttgcaattacagagatcatacgtttcctgtagttcttgaccaggtttgcacacactgcagcagggattttggcccactcctccatacagaccttctccagatctttcaggtttcggggctgtcgctgggcaatacggactttcagctccctccaaagattttctattgggttcaggtctggagactggctaggccactccaggaccttgagatgcttcttacggagccactccttagttgccctggctgtgtgtttcgggtccttgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU725192 True 283 lncRNA 0.51 1 66631747 66632029
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529003 LOC106583569 coding downstream 334539 66293286 ~ 66297208 (-)
LOC110528298 LOC106583567 coding downstream 356114 66223587 ~ 66275633 (-)
LOC110529002 LOC104927948 coding downstream 415731 66213861 ~ 66216016 (-)
LOC110528295 LOC106583570 coding downstream 427434 66140229 ~ 66204313 (-)
LOC118965412 NA coding downstream 501430 66130189 ~ 66130317 (-)
LOC110528300 LOC106583565 coding upstream 423161 67055190 ~ 67079126 (-)
LOC110529006 LOC106565368 coding upstream 447254 67079283 ~ 67092617 (-)
LOC110528304 LOC106583561 coding upstream 528907 67160936 ~ 67177650 (-)
LOC110528305 LOC106565361 coding upstream 542181 67174210 ~ 67184420 (-)
LOC110528307 LOC106583559 coding upstream 582517 67144025 ~ 67237266 (-)
G638015 NA non-coding downstream 5246 66626281 ~ 66626501 (-)
G637918 NA non-coding downstream 89487 66541956 ~ 66542260 (-)
G637916 NA non-coding downstream 90371 66541146 ~ 66541376 (-)
G637910 NA non-coding downstream 93826 66537718 ~ 66537921 (-)
G637893 NA non-coding downstream 108695 66522513 ~ 66523052 (-)
G638034 NA non-coding upstream 9203 66641232 ~ 66641532 (-)
G638045 NA non-coding upstream 13428 66645457 ~ 66645729 (-)
G638059 NA non-coding upstream 24502 66656531 ~ 66656737 (-)
G638067 NA non-coding upstream 30359 66662388 ~ 66662773 (-)
G638068 NA non-coding upstream 31105 66663134 ~ 66663389 (-)
G637722 NA other downstream 354667 66276782 ~ 66277080 (-)
G637669 NA other downstream 453852 66175960 ~ 66177895 (-)
G637504 LOC106583318 other downstream 739345 65886936 ~ 65892402 (-)
G637495 NA other downstream 749191 65881012 ~ 65882556 (-)
G636719 NA other downstream 1136590 65493790 ~ 65495157 (-)
LOC110528308 LOC106583558 other upstream 614603 67245800 ~ 67276081 (-)
G639226 LOC106583551 other upstream 782827 67414856 ~ 67416090 (-)
G641364 NA other upstream 2162565 68794594 ~ 68809149 (-)
G641913 NA other upstream 3176014 69808043 ~ 69811260 (-)

Expression


G638023 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G638023 Expression in each Bioproject

Bar chart with 21 bars.
G638023 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network