G638060



Basic Information


Item Value
gene id G638060
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 66657260 ~ 66657460 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU725229
tctacatacaatgtgagcaaatgaggtgagataagggaggtaaaggcaaaaaaggccatggtggcgaagtaaatacaatatagcaagtaaaaaaaaataataataagtaaacactggaatgatagatttgcagtggaagaatgtgcaaagtagagatagaaataatgggggtgcaaaggagcaaaataaataaataaatac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU725229 True 201 lncRNA 0.33 1 66657260 66657460
Loading

Neighbor


gene id symbol gene type direction distance location
myorg kiaa1161 coding upstream 338053 66311011 ~ 66319207 (+)
LOC110528296 ccdc63 coding upstream 443627 66204437 ~ 66213633 (+)
LOC110528290 LOC106583572 coding upstream 542702 66049287 ~ 66114558 (+)
tacc1 LOC106586881 coding upstream 618300 66002466 ~ 66038960 (+)
ddhd2 LOC106583313 coding upstream 665400 65983543 ~ 65991860 (+)
LOC110529005 LOC106583566 coding downstream 273578 66931038 ~ 67049072 (+)
LOC110528302 LOC106583563 coding downstream 444642 67102102 ~ 67112227 (+)
LOC110528303 LOC106583562 coding downstream 464731 67122191 ~ 67130475 (+)
LOC110528306 LOC106583560 coding downstream 530416 67187876 ~ 67201857 (+)
LOC110528310 LOC106583556 coding downstream 692429 67349886 ~ 67352106 (+)
G638051 NA non-coding upstream 5944 66651108 ~ 66651316 (+)
G638028 NA non-coding upstream 21625 66634856 ~ 66635635 (+)
G638006 NA non-coding upstream 38257 66618803 ~ 66619003 (+)
G638005 NA non-coding upstream 39514 66617534 ~ 66617746 (+)
G637998 NA non-coding upstream 45046 66612010 ~ 66612214 (+)
G638073 NA non-coding downstream 10514 66667974 ~ 66668179 (+)
G638078 NA non-coding downstream 12256 66669716 ~ 66669971 (+)
G638083 NA non-coding downstream 15172 66672632 ~ 66672854 (+)
G638088 NA non-coding downstream 22741 66680201 ~ 66680773 (+)
G638090 NA non-coding downstream 24215 66681675 ~ 66682206 (+)
G638011 NA other upstream 35166 66621686 ~ 66622094 (+)
G637929 NA other upstream 49516 66552588 ~ 66607744 (+)
LOC110528281 LOC106565490 other upstream 749441 65901905 ~ 65908098 (+)
G635848 NA other upstream 1326968 65329936 ~ 65330292 (+)
G635769 NA other upstream 1605104 65051644 ~ 65052156 (+)
patz1 LOC106583552 other downstream 783072 67433792 ~ 67446077 (+)
G639648 NA other downstream 1556058 68213518 ~ 68214402 (+)
LOC110528344 LOC106583528 other downstream 2096603 68568757 ~ 68790841 (+)
G640523 NA other downstream 2264166 68921626 ~ 68927219 (+)
G640895 NA other downstream 2930831 69588291 ~ 69589664 (+)

Expression


G638060 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G638060 Expression in each Bioproject

Bar chart with 18 bars.
G638060 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network