G638092



Basic Information


Item Value
gene id G638092
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 66683739 ~ 66683986 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU725261
gttagagctctaggggcgctatttcatttttggataaaaaacgttcccgttttaagcgcgatattttgtcacgaaaagatgctcgactatgcatattcttgacagttttggaaagaaaacactctgaagtttcagaatctgcaaagattttgtctgtaagtgccccagaactcattctacaggcgaaaccaagatgatgcatcacccagggattagcagaatttctgaagctctgttttccattctct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU725261 True 248 lncRNA 0.40 1 66683739 66683986
Loading

Neighbor


gene id symbol gene type direction distance location
myorg kiaa1161 coding upstream 364532 66311011 ~ 66319207 (+)
LOC110528296 ccdc63 coding upstream 470106 66204437 ~ 66213633 (+)
LOC110528290 LOC106583572 coding upstream 569181 66049287 ~ 66114558 (+)
tacc1 LOC106586881 coding upstream 644779 66002466 ~ 66038960 (+)
ddhd2 LOC106583313 coding upstream 691879 65983543 ~ 65991860 (+)
LOC110529005 LOC106583566 coding downstream 247052 66931038 ~ 67049072 (+)
LOC110528302 LOC106583563 coding downstream 418116 67102102 ~ 67112227 (+)
LOC110528303 LOC106583562 coding downstream 438205 67122191 ~ 67130475 (+)
LOC110528306 LOC106583560 coding downstream 503890 67187876 ~ 67201857 (+)
LOC110528310 LOC106583556 coding downstream 665903 67349886 ~ 67352106 (+)
G638090 NA non-coding upstream 1533 66681675 ~ 66682206 (+)
G638088 NA non-coding upstream 2966 66680201 ~ 66680773 (+)
G638083 NA non-coding upstream 10885 66672632 ~ 66672854 (+)
G638078 NA non-coding upstream 13768 66669716 ~ 66669971 (+)
G638073 NA non-coding upstream 15560 66667974 ~ 66668179 (+)
G638093 NA non-coding downstream 204 66684190 ~ 66684576 (+)
G638102 NA non-coding downstream 8240 66692226 ~ 66692480 (+)
G638103 NA non-coding downstream 9137 66693123 ~ 66693334 (+)
G638276 NA non-coding downstream 138407 66822393 ~ 66822671 (+)
G638283 NA non-coding downstream 142592 66826578 ~ 66826861 (+)
G638011 NA other upstream 61645 66621686 ~ 66622094 (+)
G637929 NA other upstream 75995 66552588 ~ 66607744 (+)
LOC110528281 LOC106565490 other upstream 775920 65901905 ~ 65908098 (+)
G635848 NA other upstream 1353447 65329936 ~ 65330292 (+)
G635769 NA other upstream 1631583 65051644 ~ 65052156 (+)
patz1 LOC106583552 other downstream 756546 67433792 ~ 67446077 (+)
G639648 NA other downstream 1529532 68213518 ~ 68214402 (+)
LOC110528344 LOC106583528 other downstream 2070077 68568757 ~ 68790841 (+)
G640523 NA other downstream 2237640 68921626 ~ 68927219 (+)
G640895 NA other downstream 2904305 69588291 ~ 69589664 (+)

Expression


G638092 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G638092 Expression in each Bioproject

Bar chart with 9 bars.
G638092 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network