G649997



Basic Information


Item Value
gene id G649997
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 77211931 ~ 77212307 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU738689
acggacctctgagactatcacagtgcaggtgcatttatacagagacttgattacacacaggtggattgtatttatcatcattagtcaattaggtcaacattggatcattcagagatcctcactaagcttctggagagagtttgctgcactgaaagtaaaggggttgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagttggaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattctttacaaaaaaatacagttttatatctttatgtttgaagcctgaaatgtgacaaaaggtcgcaaagttcaagggggccgaatactttcgcaaggcactgtacat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU738689 True 377 lncRNA 0.37 1 77211931 77212307
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528532 fndc11 coding downstream 14792 77187663 ~ 77197139 (-)
si:ch73-267c23.10 LOC106583622 coding downstream 66209 77121611 ~ 77145722 (-)
LOC110528526 NA coding downstream 100004 77106141 ~ 77111927 (-)
LOC118965366 LOC106565264 coding downstream 121558 77088808 ~ 77090373 (-)
LOC110528518 NA coding downstream 204788 77006314 ~ 77007143 (-)
LOC110529033 LOC106583621 coding upstream 5753 77218060 ~ 77231065 (-)
helz2a helz2 coding upstream 37645 77249952 ~ 77275885 (-)
LOC118965318 NA coding upstream 89153 77301460 ~ 77304319 (-)
LOC110528536 arfrp1 coding upstream 136771 77349078 ~ 77355461 (-)
LOC110529034 LOC106583646 coding upstream 168447 77380754 ~ 77390369 (-)
G649994 NA non-coding downstream 5190 77205121 ~ 77206741 (-)
G649991 NA non-coding downstream 9197 77202394 ~ 77202734 (-)
G649985 NA non-coding downstream 16046 77195544 ~ 77195885 (-)
G649984 NA non-coding downstream 16918 77194542 ~ 77195013 (-)
G649972 NA non-coding downstream 21847 77189827 ~ 77190084 (-)
G649978 LOC106583651 non-coding upstream 76060 77288367 ~ 77344077 (-)
G650044 NA non-coding upstream 167149 77379456 ~ 77380682 (-)
G650057 NA non-coding upstream 189255 77401562 ~ 77401987 (-)
LOC110528538 LOC106583648 non-coding upstream 192615 77404888 ~ 77463817 (-)
G650058 NA non-coding upstream 199085 77411392 ~ 77411620 (-)
G649684 LOC100136508 other downstream 195330 77009249 ~ 77016601 (-)
G649327 LOC106583642 other downstream 991000 76214701 ~ 76220931 (-)
G649025 NA other downstream 1590994 75619325 ~ 75623983 (-)
LOC110528488 NA other downstream 2104015 75106897 ~ 75107924 (-)
G646073 NA other downstream 3400474 73810902 ~ 73811457 (-)
G650755 cbfa2t2 other upstream 816937 78029244 ~ 78029753 (-)
G650763 NA other upstream 830992 78043299 ~ 78046469 (-)
eya2 LOC106583664 other upstream 1063841 78209092 ~ 78312601 (-)
G652578 ncoa5 other upstream 2241768 79454075 ~ 79457103 (-)

Expression


G649997 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G649997 Expression in each Bioproject

Bar chart with 19 bars.
G649997 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network