G652070 (yo84)



Basic Information


Item Value
gene id G652070
gene name yo84
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 79143336 ~ 79143858 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU740978
gggtagccggaaagtagagcgttggagtagtctaacctagaagtgacaaaagcatggattcatttttctgcatcatttttggacagaaagtttctgatttttgcaatgttacatagatggaaaaaagctgtccttgaaatggtcatgatatgttcttcaaaagagagatcagggtccagagtaacaccgaggtccttcacagttttatttgagatgactgtacaaccattaagattaattgtcagattcaacagaagatctctttgtttcttgggacctagaacaagcatctctgttttgtccgagtttaaaagtagaaagtttgcagccatcaacttccttatgtctgaaacacatgcttctagcgagggcaattttggggcttcaccatgtttcattgaaatgtacagctgtgtgtcatccgcttggcagtgaaagttaacattatgttttcgaatgacatccccaagaggtaaaatatatagtgaaaacaattagtggtcctaaaacggaaccttgagga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU740978 True 523 lncRNA 0.39 1 79143336 79143858

Neighbor


gene id symbol gene type direction distance location
LOC118965319 NA coding upstream 544222 78597699 ~ 78599114 (+)
tfap2c LOC106583667 coding upstream 674179 78447783 ~ 78469157 (+)
rtf2 LOC106583666 coding upstream 697037 78380975 ~ 78446299 (+)
LOC110528546 LOC106583653 coding upstream 894137 78193630 ~ 78249199 (+)
pxmp4 pxmp4 coding upstream 963074 78178053 ~ 78180262 (+)
LOC110528557 LOC106583675 coding downstream 177141 79320999 ~ 79338163 (+)
zgc:109913 LOC106583679 coding downstream 195367 79339225 ~ 79342142 (+)
LOC110529039 LOC106583677 coding downstream 245240 79389098 ~ 79421631 (+)
ncoa5 NA coding downstream 300614 79444472 ~ 79457104 (+)
nat8l2 LOC106583684 coding downstream 583314 79727172 ~ 79729864 (+)
G652069 NA non-coding upstream 307 79142655 ~ 79143029 (+)
G652046 NA non-coding upstream 14116 79128995 ~ 79129220 (+)
G652025 LOC106583515 non-coding upstream 30227 79112324 ~ 79113109 (+)
G651758 NA non-coding upstream 120387 79022692 ~ 79022949 (+)
G651757 NA non-coding upstream 120932 79022192 ~ 79022404 (+)
G652079 NA non-coding downstream 7133 79150991 ~ 79151396 (+)
G652087 NA non-coding downstream 17028 79160886 ~ 79161097 (+)
G652107 NA non-coding downstream 28907 79172765 ~ 79173083 (+)
G652150 NA non-coding downstream 79176 79223034 ~ 79223267 (+)
G652161 NA non-coding downstream 96523 79240381 ~ 79240658 (+)
G651075 NA other upstream 727329 78359416 ~ 78416007 (+)
G650827 NA other upstream 1033934 78107406 ~ 78109402 (+)
G650261 NA other upstream 1310275 77831000 ~ 77833061 (+)
G650282 NA other upstream 1486084 77653938 ~ 77657252 (+)
G650094 NA other upstream 1669087 77473212 ~ 77474249 (+)
G652845 NA other downstream 846751 79990609 ~ 79992859 (+)
LOC110528584 bloc1s1 other downstream 1593018 80736845 ~ 80747734 (+)
G653803 NA other downstream 1988322 81132180 ~ 81133770 (+)
G654244 NA other downstream 2065298 81209156 ~ 81209544 (+)
G654265 LOC106611445 other downstream 2182465 81326323 ~ 81352422 (+)

Expression


G652070(yo84) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G652070(yo84) Expression in each Bioproject

Bar chart with 18 bars.
G652070(yo84) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network