G654782



Basic Information


Item Value
gene id G654782
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 81951002 ~ 81951392 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU744236
gtattgaggggaggatggatggggccatgtatcgcgagatcttggccgacaacctccttccctcagtaagagcattgaagatgggtcgtggctgggtcttccagcatgacaacgacccgaaacacacagccagggcaactaaagagtggctccgtaagaagcatctcaaggtcctggagtggcctagccagtctccagaccataacccaatagaaaatctttggagggagctgaaagtctgtattgcccagcgacagccccgaaacctgaaggatctggagaaggtctgtatggaggagtgggccaaaatccctgctgcagtgtgtgaaaacctggtcaagaactacaggaaacgtatgatctctgtaattgcaaacaaaggtttctgtac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU744236 True 391 TUCP 0.51 1 81951002 81951392
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528604 LOC106583724 coding upstream 143102 81794468 ~ 81807900 (+)
LOC110528591 slc6a6 coding upstream 298061 81606542 ~ 81652941 (+)
LOC118965323 NA coding upstream 340972 81606847 ~ 81610030 (+)
lsm3 lsm3 coding upstream 512810 81432052 ~ 81438192 (+)
podxl2 LOC106583720 coding upstream 529529 81388173 ~ 81421473 (+)
LOC118965324 NA coding downstream 191014 82142401 ~ 82145175 (+)
LOC110529047 LOC106583744 coding downstream 211035 82162427 ~ 82180242 (+)
LOC110529049 LOC106583745 coding downstream 246941 82198333 ~ 82329870 (+)
dock3 LOC106583746 coding downstream 403008 82354400 ~ 82764765 (+)
LOC110525202 LOC106583751 coding downstream 822385 82773777 ~ 82778043 (+)
G654775 NA non-coding upstream 7321 81943423 ~ 81943681 (+)
G654774 NA non-coding upstream 9416 81941368 ~ 81941586 (+)
G654765 NA non-coding upstream 18454 81932324 ~ 81932548 (+)
G654764 NA non-coding upstream 18754 81931804 ~ 81932248 (+)
G654751 NA non-coding upstream 38445 81911920 ~ 81912557 (+)
G654785 NA non-coding downstream 2690 81954082 ~ 81954282 (+)
G654786 NA non-coding downstream 4146 81955538 ~ 81955769 (+)
G654790 NA non-coding downstream 10993 81962385 ~ 81962667 (+)
G654791 NA non-coding downstream 12429 81963821 ~ 81964159 (+)
G654797 NA non-coding downstream 27293 81978685 ~ 81978895 (+)
G654673 NA other upstream 142275 81744527 ~ 81808727 (+)
G654603 NA other upstream 375579 81574942 ~ 81575423 (+)
G654265 LOC106611445 other upstream 599802 81326323 ~ 81352422 (+)
G654244 NA other upstream 741458 81209156 ~ 81209544 (+)
G653803 NA other upstream 817232 81132180 ~ 81133770 (+)
G655042 NA other downstream 507693 82459085 ~ 82459667 (+)
G656125 NA other downstream 1204622 83156014 ~ 83156319 (+)
G656264 NA other downstream 1315756 83267148 ~ 83272209 (+)
G656551 NA other downstream 1607445 83558837 ~ 83560518 (+)
G657228 NA other downstream 2552157 84503549 ~ 84520418 (+)

Expression


G654782 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G654782 Expression in each Bioproject

Bar chart with 18 bars.
G654782 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network