G655743



Basic Information


Item Value
gene id G655743
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 82397001 ~ 82399776 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU745385
tccctgtgtttcctgtctctctgtaccagtgtatttatccctgtgtttcctgtctctctgtaccagtgtatttatccctgtgtttcctgtctctctgtgccagtgtattcatccctgtgtttcctgtctctctgtaccagtgtatttatccctgtgtttcctgtctctctgtaccagtgtatttatccctgtgtttcctgtctctctgtgccagtgtatttatccctgtgtttcctgtctctctgtactagtgtatttatccctgtgtttcctgtctctctgtaacagtgtatttatccctgtgtttcctgtctctctgtaacagtgtatttatcc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU745385 True 336 lncRNA 0.43 2 82397001 82399776
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528607 LOC106566201 coding downstream 244557 82145268 ~ 82152444 (-)
sec13 sec13 coding downstream 264787 82121338 ~ 82132214 (-)
LOC110528605 grip2 coding downstream 404405 81666686 ~ 81992596 (-)
LOC118965322 LOC106583721 coding downstream 966401 81423132 ~ 81430600 (-)
tma7 NA coding downstream 1043719 81351210 ~ 81353282 (-)
LOC118965368 NA coding upstream 459605 82859381 ~ 82860786 (-)
LOC110525201 LOC106583753 coding upstream 472933 82872709 ~ 83038973 (-)
LOC118965369 NA coding upstream 656225 83056001 ~ 83056432 (-)
LOC118965325 NA coding upstream 1159762 83559538 ~ 83560418 (-)
LOC110528625 LOC106583755 coding upstream 1331409 83731185 ~ 83735497 (-)
G655672 NA non-coding downstream 18740 82297373 ~ 82378261 (-)
G655715 LOC106583745 non-coding downstream 63350 82328398 ~ 82333651 (-)
G655709 LOC106583745 non-coding downstream 74937 82307579 ~ 82322064 (-)
G655673 NA non-coding downstream 99355 82255530 ~ 82297646 (-)
G655751 NA non-coding upstream 13681 82413457 ~ 82417765 (-)
G655767 NA non-coding upstream 50722 82450498 ~ 82450835 (-)
G655766 NA non-coding upstream 52551 82452327 ~ 82453169 (-)
G655780 NA non-coding upstream 73937 82473713 ~ 82481540 (-)
G655800 NA non-coding upstream 117921 82517697 ~ 82518811 (-)
G655651 NA other downstream 170456 82225952 ~ 82226545 (-)
G655469 NA other downstream 481491 81914708 ~ 81915510 (-)
G655447 NA other downstream 525484 81859371 ~ 81871517 (-)
G655433 NA other downstream 563970 81832678 ~ 81833031 (-)
G656314 NA other upstream 927703 83327479 ~ 83328180 (-)
G656671 dag1 other upstream 1208756 83608532 ~ 83615998 (-)
LOC110528632 LOC105007334 other upstream 1554471 83954195 ~ 84332909 (-)
G658255 NA other upstream 2606950 85006726 ~ 85007505 (-)
G659250 NA other upstream 3760466 86160242 ~ 86160923 (-)

Expression


G655743 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G655743 Expression in each Bioproject

Bar chart with 13 bars.
G655743 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network