G655014



Basic Information


Item Value
gene id G655014
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 82397065 ~ 82399774 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU744500
ggaaacacagggataaatacactagtacagagagacaggaaacacagggataaatacactggcacagagagacaggaaacacagggataaatacactggtacagagagacaggaaacacagggatgaatacactggcacagagagacaggaaacacagggataaatacactggtacagagagacaggaaacacagggataaatacactggtacagagagacaggaaacacagg
>TU744501
ggaaacacagggataaatacactagtacagagagacaggaaacacagggataaatacactggcacagagagacaggaaacacagggataaatacactggtacagagagacaggaaacacagggataaatacactggtacagagagacaggaaacacagggatgaatacactggcacagagagacaggaaacacagggataaatacactggtacagagagacaggaaacacagggataaatacactggtacagagagacaggaaacacagg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU744500 False 233 lncRNA 0.45 2 82397065 82399774
TU744501 True 270 lncRNA 0.44 2 82397065 82399774
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529049 LOC106583745 coding upstream 67195 82198333 ~ 82329870 (+)
LOC110529047 LOC106583744 coding upstream 216823 82162427 ~ 82180242 (+)
LOC118965324 NA coding upstream 251890 82142401 ~ 82145175 (+)
LOC110528604 LOC106583724 coding upstream 589165 81794468 ~ 81807900 (+)
LOC118965323 NA coding upstream 787035 81606847 ~ 81610030 (+)
LOC110525202 LOC106583751 coding downstream 374003 82773777 ~ 82778043 (+)
LOC110525199 LOC106583750 coding downstream 378599 82778373 ~ 82782922 (+)
LOC118965402 NA coding downstream 755845 83155619 ~ 83155719 (+)
LOC118965370 NA coding downstream 865762 83265536 ~ 83310372 (+)
dag1 dag1 coding downstream 1154509 83554283 ~ 83616043 (+)
G654995 NA non-coding upstream 31366 82364303 ~ 82365699 (+)
G654907 NA non-coding upstream 64396 82331350 ~ 82332669 (+)
G654904 NA non-coding upstream 205007 82191858 ~ 82192058 (+)
G654858 NA non-coding upstream 216029 82180311 ~ 82181036 (+)
G654889 NA non-coding upstream 236444 82160297 ~ 82160621 (+)
G655039 NA non-coding downstream 51447 82451221 ~ 82452779 (+)
G655040 NA non-coding downstream 54306 82454080 ~ 82454720 (+)
G655070 NA non-coding downstream 117169 82516943 ~ 82566820 (+)
G655106 NA non-coding downstream 199049 82598823 ~ 82599828 (+)
G655126 NA non-coding downstream 237534 82637308 ~ 82637837 (+)
G654782 NA other upstream 445673 81951002 ~ 81951392 (+)
G654673 NA other upstream 588338 81744527 ~ 81808727 (+)
G654603 NA other upstream 821642 81574942 ~ 81575423 (+)
G654265 LOC106611445 other upstream 1045865 81326323 ~ 81352422 (+)
G654244 NA other upstream 1187521 81209156 ~ 81209544 (+)
G655042 NA other downstream 59311 82459085 ~ 82459667 (+)
G656125 NA other downstream 756240 83156014 ~ 83156319 (+)
G656264 NA other downstream 867374 83267148 ~ 83272209 (+)
G656551 NA other downstream 1159063 83558837 ~ 83560518 (+)
G657228 NA other downstream 2103775 84503549 ~ 84520418 (+)

Expression


G655014 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G655014 Expression in each Bioproject

Bar chart with 17 bars.
G655014 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4000.
End of interactive chart.

Co-expression Network