G656760



Basic Information


Item Value
gene id G656760
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 83740155 ~ 83740369 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU746521
gtgcaatatgaccccatagacactgtatattcgattggcaatgagttgaaaaactacaaacctcagatttcccacttcctggttggattttttctcaggtttgtgcctgccatatgagttctgttatactcacatacatcttccaaacagttttagaaactccagagtgttttctatccaaatctactaataatatgcatatcttagcttctggg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU746521 True 215 lncRNA 0.38 1 83740155 83740369

Neighbor


gene id symbol gene type direction distance location
LOC110529053 LOC106583755 coding upstream 27952 83711361 ~ 83712203 (+)
dag1 dag1 coding upstream 124112 83554283 ~ 83616043 (+)
LOC118965370 NA coding upstream 429783 83265536 ~ 83310372 (+)
LOC118965402 NA coding upstream 584436 83155619 ~ 83155719 (+)
LOC110525199 LOC106583750 coding upstream 957233 82778373 ~ 82782922 (+)
nicn1 nicn1 coding downstream 19369 83759738 ~ 83782465 (+)
LOC118965393 NA coding downstream 60242 83800611 ~ 83802600 (+)
LOC110528627 stl3 coding downstream 137973 83878342 ~ 83881586 (+)
LOC118965371 NA coding downstream 631828 84372197 ~ 84401519 (+)
amigo3 amigo3 coding downstream 1164259 84904628 ~ 84909361 (+)
G656583 NA non-coding upstream 117967 83620859 ~ 83622188 (+)
G656580 NA non-coding upstream 122631 83616773 ~ 83617524 (+)
G656567 NA non-coding upstream 151240 83588570 ~ 83588915 (+)
G656550 NA non-coding upstream 180531 83558428 ~ 83559624 (+)
G656459 NA non-coding upstream 246460 83493305 ~ 83493695 (+)
G656808 NA non-coding downstream 49783 83790152 ~ 83790443 (+)
G656810 NA non-coding downstream 54230 83794599 ~ 83795035 (+)
G656811 NA non-coding downstream 54994 83795363 ~ 83795721 (+)
G656871 NA non-coding downstream 148803 83889172 ~ 83889915 (+)
G656878 NA non-coding downstream 155794 83896163 ~ 83908491 (+)
G656551 NA other upstream 179637 83558837 ~ 83560518 (+)
G656264 NA other upstream 467946 83267148 ~ 83272209 (+)
G656125 NA other upstream 583836 83156014 ~ 83156319 (+)
G655042 NA other upstream 1280488 82459085 ~ 82459667 (+)
G654782 NA other upstream 1788763 81951002 ~ 81951392 (+)
G657228 NA other downstream 763180 84503549 ~ 84520418 (+)
G657254 NA other downstream 811627 84551996 ~ 84554773 (+)
G657292 NA other downstream 872460 84612829 ~ 84618717 (+)
G657481 NA other downstream 1266110 85006479 ~ 85007498 (+)
G658885 NA other downstream 2146223 85886592 ~ 85887121 (+)

Expression


G656760 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G656760 Expression in each Bioproject

Bar chart with 15 bars.
G656760 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network