G658187



Basic Information


Item Value
gene id G658187
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 84866763 ~ 84867184 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU748221
gaggtcactgcatctcggtgctagaggtgtcactacagaccctggttcagaggtcactgcatctcggtgctagaggtgtcactacagaccctggttcagaggtcactgcatctcggtgctagaggtgtcactacagaccctggttcagaggtcactgcatctcggtgctagaggtgtcactacagaccctggttcagaggtcactgcatctcagtgctagaggtgtcactacagaccctggttcagaggtcactgcatctcagtgctagaggtgt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU748221 True 275 lncRNA 0.55 2 84866763 84867184
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528632 LOC105007334 coding downstream 533854 83954195 ~ 84332909 (-)
LOC110528630 stl3 coding downstream 949649 83913871 ~ 83917114 (-)
stl3 stl3 coding downstream 961497 83888444 ~ 83905266 (-)
LOC110528625 LOC106583755 coding downstream 1131266 83731185 ~ 83735497 (-)
LOC118965325 NA coding downstream 1306345 83559538 ~ 83560418 (-)
LOC110528641 terf2ip coding upstream 239787 85106971 ~ 85119900 (-)
LOC110528639 LOC106583772 coding upstream 274040 85141224 ~ 85169972 (-)
gmppb gmppb coding upstream 303934 85171118 ~ 85184654 (-)
LOC110529054 ip6k1 coding upstream 333975 85201159 ~ 85271192 (-)
ube2j2 ube2j2 coding upstream 508410 85375594 ~ 85388068 (-)
G658186 NA non-coding downstream 428 84865853 ~ 84866335 (-)
G658162 NA non-coding downstream 22951 84841327 ~ 84843812 (-)
G658161 NA non-coding downstream 67757 84797288 ~ 84799006 (-)
G658143 NA non-coding downstream 114743 84747845 ~ 84752020 (-)
G658081 NA non-coding downstream 247566 84614483 ~ 84619197 (-)
G658202 NA non-coding upstream 31381 84898565 ~ 84949853 (-)
G658273 NA non-coding upstream 186480 85053664 ~ 85058410 (-)
G658274 NA non-coding upstream 187058 85054242 ~ 85058777 (-)
G658286 NA non-coding upstream 220041 85087225 ~ 85087669 (-)
G658299 NA non-coding upstream 246837 85114021 ~ 85115111 (-)
G656671 dag1 other downstream 1250765 83608532 ~ 83615998 (-)
G656314 NA other downstream 1538583 83327479 ~ 83328180 (-)
G655715 LOC106583745 other downstream 2533465 82328398 ~ 82333651 (-)
G655651 NA other downstream 2640218 82225952 ~ 82226545 (-)
G658255 NA other upstream 139542 85006726 ~ 85007505 (-)
G659250 NA other upstream 1293058 86160242 ~ 86160923 (-)
G659543 NA other upstream 1765223 86632407 ~ 86633856 (-)
G659824 NA other upstream 2136552 87003736 ~ 87007292 (-)
LOC110528667 cenpp other upstream 2417717 87114104 ~ 87293966 (-)

Expression


G658187 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G658187 Expression in each Bioproject

Bar chart with 13 bars.
G658187 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network