G658878



Basic Information


Item Value
gene id G658878
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 85870495 ~ 85870971 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU749076
ggtagcctagtggttagagtgtagaggtggcaggttgcctagtggttagagtgtataggtggcaggtagcctagtggttagagtgtagaggtggcaggttgcctagtggttagagtgtaggggcggcaggtagcctagtggttagagtgttgggccagtaacggaaaggttgctagatcgaatccctgacctgacaaggtacaaatctgtcgttctgcccctgaacaaggcagttaccccactgttccccgg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU749076 True 252 lncRNA 0.54 2 85870495 85870971

Neighbor


gene id symbol gene type direction distance location
vgll4b vgll4 coding upstream 125701 85649845 ~ 85744794 (+)
tamm41 tamm41 coding upstream 221854 85630978 ~ 85648641 (+)
pusl1 pusl1 coding upstream 252564 85551793 ~ 85617931 (+)
LOC110528636 LOC106583767 coding upstream 506812 85301554 ~ 85363683 (+)
LOC110528638 NA coding upstream 572811 85294228 ~ 85297684 (+)
LOC110528658 slc6a1 coding downstream 147104 86018075 ~ 86033561 (+)
atp2b2 LOC106566233 coding downstream 231292 86102263 ~ 86305534 (+)
slc6a11b slc6a11 coding downstream 473754 86344725 ~ 86406029 (+)
LOC110488455 LOC106583799 coding downstream 1114580 86985551 ~ 87051602 (+)
LOC110488454 NA coding downstream 1133945 86927892 ~ 87007309 (+)
G658605 NA non-coding upstream 5952 85864179 ~ 85864543 (+)
G658594 NA non-coding upstream 45910 85824232 ~ 85824585 (+)
G658583 NA non-coding upstream 85349 85784688 ~ 85785146 (+)
G658472 NA non-coding upstream 113913 85755666 ~ 85756582 (+)
G658473 NA non-coding upstream 114943 85752533 ~ 85755552 (+)
G658884 NA non-coding downstream 4797 85875768 ~ 85875990 (+)
G658888 NA non-coding downstream 27130 85898101 ~ 85898316 (+)
G658890 NA non-coding downstream 66751 85937722 ~ 85939442 (+)
G658902 NA non-coding downstream 90614 85961585 ~ 85961887 (+)
G658903 NA non-coding downstream 93123 85964094 ~ 85964475 (+)
G657481 NA other upstream 862997 85006479 ~ 85007498 (+)
G657292 NA other upstream 1251778 84612829 ~ 84618717 (+)
G657254 NA other upstream 1315722 84551996 ~ 84554773 (+)
G657228 NA other upstream 1350077 84503549 ~ 84520418 (+)
G656551 NA other upstream 2309977 83558837 ~ 83560518 (+)
G658885 NA other downstream 15621 85886592 ~ 85887121 (+)
G658887 NA other downstream 24855 85895826 ~ 85896149 (+)
G659058 NA other downstream 537731 86408702 ~ 86412974 (+)
G659136 NA other downstream 650089 86521060 ~ 86521822 (+)
G659706 NA other downstream 1229493 87100464 ~ 87102270 (+)

Expression


G658878 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G658878 Expression in each Bioproject

Bar chart with 18 bars.
G658878 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network