G658885



Basic Information


Item Value
gene id G658885
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 85886592 ~ 85887121 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU749085
aaccaccaccatggggcactctgtccataccataaccaccaccaccatggggcactctgcccataccataaccaccaccaccatgggacactctgttcataccataaccaccaccatgggacactctgttcataccataaccaccaccaccatggggcactctgtccataccataaccaccaccaccatgggacactctgttcataccataaccaccaccatggggcactctgtccataccataaccaccaccaccatggggcactctgttcataccataaccaccaccatggggcactctgtccataccataaccaccaccaccatggggcactctgcccataccataaccaccaccaccatgggacactctgttcataccataaccaccaccatgggacactctgttcataccataaccaccaccaccatggggcactctgtccataccataaccaccaccaccatggggcactctgtccataccataaccaccaccaccatgggacactctgttcataccataacca

Function


NR:

description
PREDICTED: tektin-2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU749085 True 530 TUCP 0.53 1 85886592 85887121
Loading

Neighbor


gene id symbol gene type direction distance location
vgll4b vgll4 coding upstream 141798 85649845 ~ 85744794 (+)
tamm41 tamm41 coding upstream 237951 85630978 ~ 85648641 (+)
pusl1 pusl1 coding upstream 268661 85551793 ~ 85617931 (+)
LOC110528636 LOC106583767 coding upstream 522909 85301554 ~ 85363683 (+)
LOC110528638 NA coding upstream 588908 85294228 ~ 85297684 (+)
LOC110528658 slc6a1 coding downstream 130954 86018075 ~ 86033561 (+)
atp2b2 LOC106566233 coding downstream 215142 86102263 ~ 86305534 (+)
slc6a11b slc6a11 coding downstream 457604 86344725 ~ 86406029 (+)
LOC110488455 LOC106583799 coding downstream 1098430 86985551 ~ 87051602 (+)
LOC110488454 NA coding downstream 1117795 86927892 ~ 87007309 (+)
G658884 NA non-coding upstream 10602 85875768 ~ 85875990 (+)
G658878 NA non-coding upstream 15621 85870495 ~ 85870971 (+)
G658605 NA non-coding upstream 22049 85864179 ~ 85864543 (+)
G658594 NA non-coding upstream 62007 85824232 ~ 85824585 (+)
G658583 NA non-coding upstream 101446 85784688 ~ 85785146 (+)
G658888 NA non-coding downstream 10980 85898101 ~ 85898316 (+)
G658890 NA non-coding downstream 50601 85937722 ~ 85939442 (+)
G658902 NA non-coding downstream 74464 85961585 ~ 85961887 (+)
G658903 NA non-coding downstream 76973 85964094 ~ 85964475 (+)
G658904 NA non-coding downstream 81214 85968335 ~ 85974861 (+)
G657481 NA other upstream 879094 85006479 ~ 85007498 (+)
G657292 NA other upstream 1267875 84612829 ~ 84618717 (+)
G657254 NA other upstream 1331819 84551996 ~ 84554773 (+)
G657228 NA other upstream 1366174 84503549 ~ 84520418 (+)
G656551 NA other upstream 2326074 83558837 ~ 83560518 (+)
G658887 NA other downstream 8705 85895826 ~ 85896149 (+)
G659058 NA other downstream 521581 86408702 ~ 86412974 (+)
G659136 NA other downstream 633939 86521060 ~ 86521822 (+)
G659706 NA other downstream 1213343 87100464 ~ 87102270 (+)
nisch LOC106583810 other downstream 1497778 87346077 ~ 87387283 (+)

Expression


G658885 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G658885 Expression in each Bioproject

Bar chart with 14 bars.
G658885 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network