G658887



Basic Information


Item Value
gene id G658887
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 85895826 ~ 85896149 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU749087
gttcataccataaccaccaccatggggcactctgttcataccataaccaccaccagcatgggacactctgttcataccataaccaccaccaccatgggacactctgttcataccataaccaccaccaccatggggcactctgtccataccataaccaccaccatggggcactctgttcataccataaccaccaccagcatgggacactctgttcataccataaccaccaccaccatgggacactctgttcataccataaccaccaccaccatggggcactctgtccataccataaccaccaccatggggcactctgttcatacc

Function


NR:

description
PREDICTED: zinc finger protein 804A-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU749087 True 324 TUCP 0.52 1 85895826 85896149
Loading

Neighbor


gene id symbol gene type direction distance location
vgll4b vgll4 coding upstream 151032 85649845 ~ 85744794 (+)
tamm41 tamm41 coding upstream 247185 85630978 ~ 85648641 (+)
pusl1 pusl1 coding upstream 277895 85551793 ~ 85617931 (+)
LOC110528636 LOC106583767 coding upstream 532143 85301554 ~ 85363683 (+)
LOC110528638 NA coding upstream 598142 85294228 ~ 85297684 (+)
LOC110528658 slc6a1 coding downstream 121926 86018075 ~ 86033561 (+)
atp2b2 LOC106566233 coding downstream 206114 86102263 ~ 86305534 (+)
slc6a11b slc6a11 coding downstream 448576 86344725 ~ 86406029 (+)
LOC110488455 LOC106583799 coding downstream 1089402 86985551 ~ 87051602 (+)
LOC110488454 NA coding downstream 1108767 86927892 ~ 87007309 (+)
G658884 NA non-coding upstream 19836 85875768 ~ 85875990 (+)
G658878 NA non-coding upstream 24855 85870495 ~ 85870971 (+)
G658605 NA non-coding upstream 31283 85864179 ~ 85864543 (+)
G658594 NA non-coding upstream 71241 85824232 ~ 85824585 (+)
G658583 NA non-coding upstream 110680 85784688 ~ 85785146 (+)
G658888 NA non-coding downstream 1952 85898101 ~ 85898316 (+)
G658890 NA non-coding downstream 41573 85937722 ~ 85939442 (+)
G658902 NA non-coding downstream 65436 85961585 ~ 85961887 (+)
G658903 NA non-coding downstream 67945 85964094 ~ 85964475 (+)
G658904 NA non-coding downstream 72186 85968335 ~ 85974861 (+)
G658885 NA other upstream 8705 85886592 ~ 85887121 (+)
G657481 NA other upstream 888328 85006479 ~ 85007498 (+)
G657292 NA other upstream 1277109 84612829 ~ 84618717 (+)
G657254 NA other upstream 1341053 84551996 ~ 84554773 (+)
G657228 NA other upstream 1375408 84503549 ~ 84520418 (+)
G659058 NA other downstream 512553 86408702 ~ 86412974 (+)
G659136 NA other downstream 624911 86521060 ~ 86521822 (+)
G659706 NA other downstream 1204315 87100464 ~ 87102270 (+)
nisch LOC106583810 other downstream 1488750 87346077 ~ 87387283 (+)
G660790 NA other downstream 2526615 88422764 ~ 88427927 (+)

Expression


G658887 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G658887 Expression in each Bioproject

Bar chart with 9 bars.
G658887 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network