G658934



Basic Information


Item Value
gene id G658934
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 86069510 ~ 86076719 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU749169
atgtctagtctcatttagggctctaatctgatagtggtagtgggctggtagatgtctagtctcctttatggctctaatctgatagtggtagtggggtggtagttgtctagtctcctttatggctctaatctgatagtggtagatgtctagtctccattatggctctaatctgatagtggtagtgtggtggtagatgtctagtctccttta

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU749169 True 210 lncRNA 0.43 2 86069510 86076719

Neighbor


gene id symbol gene type direction distance location
LOC110528658 slc6a1 coding upstream 35949 86018075 ~ 86033561 (+)
vgll4b vgll4 coding upstream 324716 85649845 ~ 85744794 (+)
tamm41 tamm41 coding upstream 420869 85630978 ~ 85648641 (+)
pusl1 pusl1 coding upstream 451579 85551793 ~ 85617931 (+)
LOC110528636 LOC106583767 coding upstream 705827 85301554 ~ 85363683 (+)
atp2b2 LOC106566233 coding downstream 25544 86102263 ~ 86305534 (+)
slc6a11b slc6a11 coding downstream 268006 86344725 ~ 86406029 (+)
LOC110488455 LOC106583799 coding downstream 908832 86985551 ~ 87051602 (+)
LOC110488454 NA coding downstream 928197 86927892 ~ 87007309 (+)
si:dkey-42i9.4 btg1 coding downstream 977795 87054514 ~ 87056155 (+)
G658927 NA non-coding upstream 55706 86011027 ~ 86013804 (+)
G658919 NA non-coding upstream 65548 86003731 ~ 86003962 (+)
G658918 NA non-coding upstream 67752 86001279 ~ 86001758 (+)
G658912 NA non-coding upstream 73819 85995405 ~ 85995691 (+)
G658904 NA non-coding upstream 94649 85968335 ~ 85974861 (+)
G658962 NA non-coding downstream 53257 86129976 ~ 86131547 (+)
G658968 NA non-coding downstream 66407 86143126 ~ 86144535 (+)
G658973 NA non-coding downstream 75543 86152262 ~ 86152629 (+)
G658975 NA non-coding downstream 83572 86160291 ~ 86523925 (+)
G658976 NA non-coding downstream 85668 86162387 ~ 86163235 (+)
G658887 NA other upstream 173361 85895826 ~ 85896149 (+)
G658885 NA other upstream 182389 85886592 ~ 85887121 (+)
G657481 NA other upstream 1062012 85006479 ~ 85007498 (+)
G657292 NA other upstream 1450793 84612829 ~ 84618717 (+)
G657254 NA other upstream 1514737 84551996 ~ 84554773 (+)
G659058 NA other downstream 331983 86408702 ~ 86412974 (+)
G659136 NA other downstream 444341 86521060 ~ 86521822 (+)
G659706 NA other downstream 1023745 87100464 ~ 87102270 (+)
nisch LOC106583810 other downstream 1308180 87346077 ~ 87387283 (+)
G660790 NA other downstream 2346045 88422764 ~ 88427927 (+)

Expression


G658934 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G658934 Expression in each Bioproject

Bar chart with 9 bars.
G658934 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network