G659274



Basic Information


Item Value
gene id G659274
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 86224932 ~ 86225216 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU749667
GATACTAGTTATTAGAGCTGCAACAGATCAGATACTAGTTATTAGAGCTGCAACAGATCAGATACTAGTTATTAGAGCTGCAACAGATCAGATACTAGTTATTAGAGCTGCAACACATTAGATACTAGTTATTAGAGCTGCAACATATCAGATACTAGTTATTAGAGCTGCAACACATTAGATACTAGTTATTAGAGCTGCAACATATCAGATACTAGTTATTAAAGCTGCAACAGATCAGATACTAGTTATTAG

Function


NR:

description
PREDICTED: uncharacterized protein LOC106581004

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU749667 True 255 lncRNA 0.34 2 86224932 86225216

Neighbor


gene id symbol gene type direction distance location
LOC118965394 NA coding downstream 217876 86004625 ~ 86007056 (-)
hrh1 hrh1 coding downstream 360383 85856689 ~ 85864549 (-)
atg7 atg7 coding downstream 369080 85764638 ~ 85855852 (-)
LOC118965326 NA coding downstream 666600 85557907 ~ 85558332 (-)
LOC110511195 LOC106583764 coding downstream 673212 85392855 ~ 85551720 (-)
slc6a1b slc6a1 coding upstream 292278 86517494 ~ 86549674 (-)
LOC110528661 dusp7 coding upstream 461056 86686272 ~ 86704088 (-)
LOC118965395 NA coding upstream 489063 86714279 ~ 86715176 (-)
poc1a poc1a coding upstream 498552 86723768 ~ 86820513 (-)
LOC110528663 LOC106583798 coding upstream 719581 86944797 ~ 86966992 (-)
G659260 NA non-coding downstream 23583 86199811 ~ 86201349 (-)
G659232 NA non-coding downstream 113114 86110503 ~ 86111818 (-)
G659225 NA non-coding downstream 127793 86096215 ~ 86097139 (-)
G659191 NA non-coding downstream 206344 86018078 ~ 86018588 (-)
G659287 NA non-coding upstream 22876 86248092 ~ 86249178 (-)
G659164 NA non-coding upstream 31658 86256874 ~ 86257591 (-)
G659291 LOC106566233 non-coding upstream 34669 86259885 ~ 86260746 (-)
G659304 NA non-coding upstream 60217 86285433 ~ 86287489 (-)
G659308 NA non-coding upstream 68957 86294173 ~ 86295944 (-)
G659250 NA other downstream 64009 86160242 ~ 86160923 (-)
G658255 NA other downstream 1217427 85006726 ~ 85007505 (-)
LOC110528632 LOC105007334 other downstream 2268164 83954195 ~ 84332909 (-)
G656671 dag1 other downstream 2608934 83608532 ~ 83615998 (-)
G656314 NA other downstream 2896752 83327479 ~ 83328180 (-)
G659543 NA other upstream 407191 86632407 ~ 86633856 (-)
G659824 NA other upstream 778520 87003736 ~ 87007292 (-)
LOC110528667 cenpp other upstream 1059685 87114104 ~ 87293966 (-)
LOC110528687 LOC106583825 other upstream 2027847 88253063 ~ 88345745 (-)
G661128 NA other upstream 2534277 88759493 ~ 88759938 (-)

Expression


G659274 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G659274 Expression in each Bioproject

Bar chart with 5 bars.
G659274 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network