G659701



Basic Information


Item Value
gene id G659701
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 87081354 ~ 87089713 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU750281
tccagactggatctatagctgtcagggttatgaaacctgtctctatccaggctggatctatagctgtcagggttattaaacctgtctgtctctatccagactggatctatagctgtcagggttatgaaacctgtctgtctctatccaggctggatctatagctgtcagggttatgaaacctgtctgtctctatccagactggatctatagctgtcagggttatgaaacctgtctctatccaggctggatctatagctgtcagggttattaaacctgtctctatccagactggatctatagctgtcaggg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU750281 True 309 lncRNA 0.46 2 87081354 87089713
Loading

Neighbor


gene id symbol gene type direction distance location
si:dkey-42i9.4 btg1 coding upstream 25199 87054514 ~ 87056155 (+)
LOC110488454 NA coding upstream 74045 86927892 ~ 87007309 (+)
LOC110488455 LOC106583799 coding upstream 76949 86985551 ~ 87051602 (+)
slc6a11b slc6a11 coding upstream 675325 86344725 ~ 86406029 (+)
atp2b2 LOC106566233 coding upstream 775820 86102263 ~ 86305534 (+)
ecm2 ecm2 coding downstream 27047 87116760 ~ 87156905 (+)
aspn aspn coding downstream 79878 87169591 ~ 87198009 (+)
ogna LOC106583805 coding downstream 143239 87232952 ~ 87249174 (+)
nol8 nol8 coding downstream 204251 87293964 ~ 87315116 (+)
nisch LOC106583810 coding downstream 256364 87346077 ~ 87387283 (+)
G659672 NA non-coding upstream 63794 87016364 ~ 87017560 (+)
G659668 NA non-coding upstream 68192 87012493 ~ 87013162 (+)
G659640 LOC106583798 non-coding upstream 114280 86944798 ~ 86967074 (+)
G659709 NA non-coding downstream 20517 87110230 ~ 87114200 (+)
G659711 NA non-coding downstream 25361 87115074 ~ 87115355 (+)
G659715 NA non-coding downstream 38193 87127906 ~ 87128999 (+)
G659722 NA non-coding downstream 61196 87150909 ~ 87151382 (+)
G659707 NA non-coding downstream 68703 87158416 ~ 87159138 (+)
G659136 NA other upstream 559532 86521060 ~ 86521822 (+)
G659058 NA other upstream 668769 86408702 ~ 86412974 (+)
G658887 NA other upstream 1185205 85895826 ~ 85896149 (+)
G658885 NA other upstream 1194233 85886592 ~ 85887121 (+)
G657481 NA other upstream 2073856 85006479 ~ 85007498 (+)
G659706 NA other downstream 10751 87100464 ~ 87102270 (+)
G660790 NA other downstream 1333051 88422764 ~ 88427927 (+)
G660853 NA other downstream 1532600 88622313 ~ 88689342 (+)
G660886 NA other downstream 1602181 88691894 ~ 88694076 (+)

Expression


G659701 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G659701 Expression in each Bioproject

Bar chart with 16 bars.
G659701 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network