G659706



Basic Information


Item Value
gene id G659706
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 87100464 ~ 87102270 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU750287
tggtaccctattccctctgggccctggtcaaatggtaccctattccctctgggccctggtcaaatggaaccctattccctatgggccctggtcaaatggtaccctattccctatgggccctggtcaaatggaaccctattccctctgggccctggtcaaatggtaccctattccctctgggccctggtcaaatggaaccctattccctctgggccctggtcaaatggtaccctattccctctgggccctggtcaaatggaaccctattccctctgggccctggtcaaatggtaccctattccctctgggccctagtcaaatggtaccctattccctctggggccctggtcaaatcgaaccctattccctatgggccctggtcaaatggtaccctattccctctgggccc

Function


NR:

description
PREDICTED: protein FAM83H-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU750287 True 409 TUCP 0.56 2 87100464 87102270

Neighbor


gene id symbol gene type direction distance location
si:dkey-42i9.4 btg1 coding upstream 44309 87054514 ~ 87056155 (+)
LOC110488454 NA coding upstream 93155 86927892 ~ 87007309 (+)
LOC110488455 LOC106583799 coding upstream 96059 86985551 ~ 87051602 (+)
slc6a11b slc6a11 coding upstream 694435 86344725 ~ 86406029 (+)
atp2b2 LOC106566233 coding upstream 794930 86102263 ~ 86305534 (+)
ecm2 ecm2 coding downstream 14490 87116760 ~ 87156905 (+)
aspn aspn coding downstream 67321 87169591 ~ 87198009 (+)
ogna LOC106583805 coding downstream 130682 87232952 ~ 87249174 (+)
nol8 nol8 coding downstream 191694 87293964 ~ 87315116 (+)
nisch LOC106583810 coding downstream 243807 87346077 ~ 87387283 (+)
G659701 NA non-coding upstream 10751 87081354 ~ 87089713 (+)
G659672 NA non-coding upstream 82904 87016364 ~ 87017560 (+)
G659668 NA non-coding upstream 87302 87012493 ~ 87013162 (+)
G659709 NA non-coding downstream 7960 87110230 ~ 87114200 (+)
G659711 NA non-coding downstream 12804 87115074 ~ 87115355 (+)
G659715 NA non-coding downstream 25636 87127906 ~ 87128999 (+)
G659722 NA non-coding downstream 48639 87150909 ~ 87151382 (+)
G659707 NA non-coding downstream 56146 87158416 ~ 87159138 (+)
G659136 NA other upstream 578642 86521060 ~ 86521822 (+)
G659058 NA other upstream 687879 86408702 ~ 86412974 (+)
G658887 NA other upstream 1204315 85895826 ~ 85896149 (+)
G658885 NA other upstream 1213343 85886592 ~ 85887121 (+)
G657481 NA other upstream 2092966 85006479 ~ 85007498 (+)
G660790 NA other downstream 1320494 88422764 ~ 88427927 (+)
G660853 NA other downstream 1520043 88622313 ~ 88689342 (+)
G660886 NA other downstream 1589624 88691894 ~ 88694076 (+)
G661162 NA other downstream 1714815 88817085 ~ 88817655 (+)

Expression


G659706 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G659706 Expression in each Bioproject

Bar chart with 10 bars.
G659706 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network