G661426 (LOC106583832)



Basic Information


Item Value
gene id G661426
gene name LOC106583832
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 89053076 ~ 89061481 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU752665
TTTGGCTTCTTGGATGGGTGGATTGGGTCTTTGATGTTTGACAGGAAGGATAAGTCCCTCTTGACGGCGTTCTTTTTCCTCCTGATGGGGAACTCATCAATCTTCAACTCTCCTTCGTCTGACACGTACTCATACTCGTCTCTCACCGGCTTGGCCTTGTCCTCCTTTAGGTTTTGTAACGAGCTGAACACACTGGAGTTGGTCTGGGGCTTCAGCTTAGAACCTAGTAACTTCTTGTGTGTCAATGAGAATGAAAACTTGTCTTTGTTGCCTGATAGTGGCGTTCTCTCAAACTTGTGCTCTTCAGTTTCCATCTTCAGTAAGGAATCTGGTTTGCTGTTCTTATATTTCCACTTGGCTTCCGTCTGTTTCTTGTTCTGTTCTCGGATCTCAAACTTCTCCAGGTCGTTCTGCTTACAGGTGTC

Function


NR:

description
PREDICTED: lysine-specific demethylase phf2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU752665 True 425 TUCP 0.46 4 89053076 89061481

Neighbor


gene id symbol gene type direction distance location
pdcd2l LOC106583835 coding downstream 273606 88777751 ~ 88779470 (-)
LOC110528689 NA coding downstream 410527 88585172 ~ 88642549 (-)
dyrk3 LOC106583824 coding downstream 598986 88421430 ~ 88454090 (-)
LOC118965327 NA coding downstream 633476 88417178 ~ 88420395 (-)
LOC110528687 LOC106583825 coding downstream 707331 88253063 ~ 88345745 (-)
LOC110528694 LOC106583841 coding upstream 327312 89388793 ~ 89392239 (-)
LOC110528698 wnt7a coding upstream 526616 89588097 ~ 89672181 (-)
LOC110528697 LOC107727849 coding upstream 638131 89699612 ~ 89827294 (-)
hdac11 hdac11 coding upstream 825091 89886572 ~ 89946188 (-)
LOC118965398 NA coding upstream 1198172 90259653 ~ 90259806 (-)
G661424 NA non-coding downstream 724 89051503 ~ 89052352 (-)
G661414 NA non-coding downstream 23350 89028984 ~ 89029726 (-)
G661400 NA non-coding downstream 56335 88995303 ~ 88996741 (-)
G661390 NA non-coding downstream 75425 88975934 ~ 88977651 (-)
G661389 NA non-coding downstream 77234 88972488 ~ 88975842 (-)
G661454 NA non-coding upstream 60066 89121547 ~ 89125563 (-)
G661459 NA non-coding upstream 74073 89135554 ~ 89137567 (-)
G661487 NA non-coding upstream 115720 89177201 ~ 89177619 (-)
G661498 yo84 non-coding upstream 128451 89189932 ~ 89190149 (-)
G661503 NA non-coding upstream 130554 89192035 ~ 89192240 (-)
G661128 NA other downstream 293138 88759493 ~ 88759938 (-)
LOC110528667 cenpp other downstream 1759321 87114104 ~ 87293966 (-)
G659824 NA other downstream 2045784 87003736 ~ 87007292 (-)
G659543 NA other downstream 2419220 86632407 ~ 86633856 (-)
G661335 NA other upstream 35566 88831729 ~ 89104274 (-)
G661773 LOC106583842 other upstream 396670 89458151 ~ 89459700 (-)
G662321 NA other upstream 615608 89677089 ~ 89681607 (-)
G662500 iqsec1 other upstream 1100657 90162138 ~ 90162948 (-)
G662629 NA other upstream 1390806 90452079 ~ 90453988 (-)

Expression


G661426(LOC106583832) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G661426(LOC106583832) Expression in each Bioproject

Bar chart with 9 bars.
G661426(LOC106583832) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network