G661454



Basic Information


Item Value
gene id G661454
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 89121547 ~ 89125563 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU752701
actacagtatgttctatagaggtgaaccatcccaacaggatacattactacattactacagtatgttctatagaggtgaaccatcccaacaggatatattactacagtatgttctatataggtgaaccatcccaacaggatatattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacagtatgttctatagaggtgtaccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacagtatgttctatagaggtgttccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactac
>TU752703
ggatacattactacagtatgttctatagaggtgtaccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatatattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacagtatgttctatagaggtgttccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactacagtatgttctatagaggtgaaccatcccaacaggatacattactac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU752701 False 681 lncRNA 0.38 4 89121547 89125563
TU752703 True 382 lncRNA 0.39 4 89121547 89123520
Loading

Neighbor


gene id symbol gene type direction distance location
pdcd2l LOC106583835 coding downstream 342077 88777751 ~ 88779470 (-)
LOC110528689 NA coding downstream 478998 88585172 ~ 88642549 (-)
dyrk3 LOC106583824 coding downstream 667457 88421430 ~ 88454090 (-)
LOC118965327 NA coding downstream 701947 88417178 ~ 88420395 (-)
LOC110528687 LOC106583825 coding downstream 775802 88253063 ~ 88345745 (-)
LOC110528694 LOC106583841 coding upstream 263230 89388793 ~ 89392239 (-)
LOC110528698 wnt7a coding upstream 462534 89588097 ~ 89672181 (-)
LOC110528697 LOC107727849 coding upstream 574049 89699612 ~ 89827294 (-)
hdac11 hdac11 coding upstream 761009 89886572 ~ 89946188 (-)
LOC118965398 NA coding upstream 1134090 90259653 ~ 90259806 (-)
G661335 NA non-coding downstream 17273 88831729 ~ 89104274 (-)
G661424 NA non-coding downstream 69195 89051503 ~ 89052352 (-)
G661414 NA non-coding downstream 91821 89028984 ~ 89029726 (-)
G661400 NA non-coding downstream 124806 88995303 ~ 88996741 (-)
G661390 NA non-coding downstream 143896 88975934 ~ 88977651 (-)
G661459 NA non-coding upstream 9991 89135554 ~ 89137567 (-)
G661487 NA non-coding upstream 51638 89177201 ~ 89177619 (-)
G661498 yo84 non-coding upstream 64369 89189932 ~ 89190149 (-)
G661503 NA non-coding upstream 66472 89192035 ~ 89192240 (-)
G661504 NA non-coding upstream 66860 89192423 ~ 89192725 (-)
G661426 LOC106583832 other downstream 60066 89053076 ~ 89061481 (-)
G661128 NA other downstream 361609 88759493 ~ 88759938 (-)
LOC110528667 cenpp other downstream 1827792 87114104 ~ 87293966 (-)
G661773 LOC106583842 other upstream 332588 89458151 ~ 89459700 (-)
G662321 NA other upstream 551526 89677089 ~ 89681607 (-)
G662500 iqsec1 other upstream 1036575 90162138 ~ 90162948 (-)
G662629 NA other upstream 1326724 90452079 ~ 90453988 (-)
G662819 NA other upstream 1617029 90742592 ~ 90764290 (-)

Expression


G661454 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G661454 Expression in each Bioproject

Bar chart with 7 bars.
G661454 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network