G661760



Basic Information


Item Value
gene id G661760
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 89429332 ~ 89429640 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU753061
cctctctctcctacctcatttgcacatgctgaatatagatttttctactgtattattgattgtatgtttgtttattccatgtgtaactgttgttttatgtgtcgaactgttttgctttatcttggccaggtcgcagttgcaaatgagaacttgttcacaactagcctatctggttaaataaaggtgaaaaacaacaaacctgcgaagagagggccgcccaccaaaactcatggaccaggcaatgagggcattaatcagagaggcaacaaagaaaccaaagataaccctgaaggagctgctccacagcgg

Function


NR:

description
uncharacterized protein LOC103041334

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU753061 True 309 lncRNA 0.42 1 89429332 89429640
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528694 LOC106583841 coding downstream 37093 89388793 ~ 89392239 (-)
pdcd2l LOC106583835 coding downstream 649862 88777751 ~ 88779470 (-)
LOC110528689 NA coding downstream 786783 88585172 ~ 88642549 (-)
dyrk3 LOC106583824 coding downstream 975242 88421430 ~ 88454090 (-)
LOC118965327 NA coding downstream 1009732 88417178 ~ 88420395 (-)
LOC110528698 wnt7a coding upstream 158457 89588097 ~ 89672181 (-)
LOC110528697 LOC107727849 coding upstream 269972 89699612 ~ 89827294 (-)
hdac11 hdac11 coding upstream 456932 89886572 ~ 89946188 (-)
LOC118965398 NA coding upstream 830013 90259653 ~ 90259806 (-)
LOC118965428 NA coding upstream 831290 90260930 ~ 90261083 (-)
G661758 NA non-coding downstream 1134 89427903 ~ 89428198 (-)
G661757 NA non-coding downstream 1551 89427545 ~ 89427781 (-)
G661756 NA non-coding downstream 3647 89425413 ~ 89425685 (-)
G661754 NA non-coding downstream 12739 89416381 ~ 89416593 (-)
G661753 NA non-coding downstream 13954 89414886 ~ 89415378 (-)
G661775 NA non-coding upstream 32585 89462225 ~ 89471122 (-)
G661780 NA non-coding upstream 47076 89476716 ~ 89478355 (-)
G661831 NA non-coding upstream 146204 89575844 ~ 89576055 (-)
G661834 NA non-coding upstream 148938 89578578 ~ 89579330 (-)
G661836 NA non-coding upstream 149781 89579421 ~ 89579886 (-)
G661335 NA other downstream 330754 88831729 ~ 89104274 (-)
G661426 LOC106583832 other downstream 367851 89053076 ~ 89061481 (-)
G661128 NA other downstream 669394 88759493 ~ 88759938 (-)
LOC110528687 LOC106583825 other downstream 1169927 88253063 ~ 88345745 (-)
LOC110528667 cenpp other downstream 2135577 87114104 ~ 87293966 (-)
G661773 LOC106583842 other upstream 28511 89458151 ~ 89459700 (-)
G662321 NA other upstream 247449 89677089 ~ 89681607 (-)
G662500 iqsec1 other upstream 732498 90162138 ~ 90162948 (-)
G662629 NA other upstream 1022647 90452079 ~ 90453988 (-)
G662819 NA other upstream 1312952 90742592 ~ 90764290 (-)

Expression


G661760 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G661760 Expression in each Bioproject

Bar chart with 16 bars.
G661760 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network