G661836



Basic Information


Item Value
gene id G661836
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 89579421 ~ 89579886 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU753162
ctgactggactctacccacacactgactggactctacccacacactgactggactctacccacacactgactggactctacccacactgactggactctacccacacactgactggactctagccacacactgactggactctacccacacactgactggactctacccacacactgactggactctacccacactgactggactctacccacacactgactggactctacccacacactgactggactctacccacacactgactggattctacccgcacactgactggactctacccgcacactgactggactctacccacactgactggactctacccacacactgactagactctatccacactgactggactctatccacactgactggactctacccacacactgactggactctacccacacactgactggactctacccacacactgactggactcta

Function


NR:

description
uncharacterized protein LOC110522718

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU753162 True 466 lncRNA 0.54 1 89579421 89579886
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528694 LOC106583841 coding downstream 187182 89388793 ~ 89392239 (-)
pdcd2l LOC106583835 coding downstream 799951 88777751 ~ 88779470 (-)
LOC110528689 NA coding downstream 936872 88585172 ~ 88642549 (-)
dyrk3 LOC106583824 coding downstream 1125331 88421430 ~ 88454090 (-)
LOC118965327 NA coding downstream 1159821 88417178 ~ 88420395 (-)
LOC110528698 wnt7a coding upstream 8211 89588097 ~ 89672181 (-)
LOC110528697 LOC107727849 coding upstream 119726 89699612 ~ 89827294 (-)
hdac11 hdac11 coding upstream 306686 89886572 ~ 89946188 (-)
LOC118965398 NA coding upstream 679767 90259653 ~ 90259806 (-)
LOC118965428 NA coding upstream 681044 90260930 ~ 90261083 (-)
G661834 NA non-coding downstream 91 89578578 ~ 89579330 (-)
G661831 NA non-coding downstream 3366 89575844 ~ 89576055 (-)
G661780 NA non-coding downstream 101066 89476716 ~ 89478355 (-)
G661775 NA non-coding downstream 108299 89462225 ~ 89471122 (-)
G661760 NA non-coding downstream 149781 89429332 ~ 89429640 (-)
G661837 NA non-coding upstream 91 89579977 ~ 89580573 (-)
G662281 NA non-coding upstream 7459 89587345 ~ 89587665 (-)
G662289 NA non-coding upstream 19788 89599674 ~ 89600135 (-)
G662292 NA non-coding upstream 26425 89606311 ~ 89612296 (-)
G662304 NA non-coding upstream 65993 89645879 ~ 89646399 (-)
G661773 LOC106583842 other downstream 119721 89458151 ~ 89459700 (-)
G661335 NA other downstream 480843 88831729 ~ 89104274 (-)
G661426 LOC106583832 other downstream 517940 89053076 ~ 89061481 (-)
G661128 NA other downstream 819483 88759493 ~ 88759938 (-)
LOC110528687 LOC106583825 other downstream 1320016 88253063 ~ 88345745 (-)
G662321 NA other upstream 97203 89677089 ~ 89681607 (-)
G662500 iqsec1 other upstream 582252 90162138 ~ 90162948 (-)
G662629 NA other upstream 872401 90452079 ~ 90453988 (-)
G662819 NA other upstream 1162706 90742592 ~ 90764290 (-)

Expression


G661836 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G661836 Expression in each Bioproject

Bar chart with 18 bars.
G661836 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network