LOC118965663



Basic Information


Item Value
gene id LOC118965663
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 33410866 ~ 33411152 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005053041.1
CATTTGCAACCTTGTGACATACTCTTGCAAGGACAATTGCTTGTGGCGAAACAAGGTTGCATAAATTAAAATAAGGAAGCTAAGGCGTGACTTCTGGAGGTTCAGGAGTTTCACGTGCGATGTTCCTTGGACAGATTCTCTACGGAGAACCCTGCTTTCCACGGCGGTGACGGAACCACATGTACCGTCACCTTTCTTGAAGCAGGAAGAAAAAGCAATTTGCGGTAACCAGACATTGTTTGCAAGGGGAAGATTTTCCTGTCATGCACTGTCGAGTTGCCACATTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005053041.1 True 287 mRNA 0.46 1 33410866 33411152

Neighbor


gene id symbol gene type direction distance location
LOC110529232 NA coding downstream 5014 33390977 ~ 33405852 (-)
LOC110529821 LOC106571616 coding downstream 398876 32977796 ~ 33011990 (-)
LOC110529818 rnaseh1 coding downstream 728340 32670745 ~ 32682526 (-)
myt1la LOC106571614 coding downstream 772017 32590298 ~ 32638849 (-)
cep43 LOC106571617 coding downstream 820978 32570016 ~ 32589888 (-)
ints9 ints9 coding upstream 15365 33426517 ~ 33435877 (-)
LOC110529827 LOC106606921 coding upstream 43135 33454287 ~ 33458472 (-)
LOC110529828 LOC106571602 coding upstream 73649 33484801 ~ 33549308 (-)
LOC110529832 fbxo16 coding upstream 274217 33685369 ~ 33689052 (-)
cdc42bpab LOC106571585 coding upstream 308222 33719374 ~ 33822238 (-)
G698742 NA non-coding downstream 135914 33274665 ~ 33274952 (-)
G698729 NA non-coding downstream 143717 33266871 ~ 33267149 (-)
G698663 NA non-coding downstream 195897 33214729 ~ 33214969 (-)
G698474 NA non-coding downstream 322258 33088396 ~ 33088608 (-)
G698373 NA non-coding downstream 404221 33006416 ~ 33006645 (-)
G698986 NA non-coding upstream 10284 33421436 ~ 33424015 (-)
G699093 NA non-coding upstream 175267 33586419 ~ 33586673 (-)
G699309 NA non-coding upstream 210526 33621678 ~ 33622113 (-)
G699311 NA non-coding upstream 215087 33626239 ~ 33626569 (-)
G699323 NA non-coding upstream 236284 33647436 ~ 33647645 (-)
G698356 NA other downstream 420805 32989245 ~ 32990061 (-)
G697774 LOC106571626 other downstream 911456 32498799 ~ 32499410 (-)
LOC110529804 ypel5 other downstream 1193317 32214451 ~ 32217572 (-)
LOC110529793 LOC106571728 other downstream 1731131 31657632 ~ 31703525 (-)
G696499 NA other downstream 1932839 31477354 ~ 31478027 (-)
G699468 NA other upstream 531870 33943022 ~ 33952356 (-)
ankef1a LOC106571587 other upstream 612139 34017010 ~ 34029131 (-)
G701454 NA other upstream 2171846 35582998 ~ 35589877 (-)
LOC110529865 LOC106571568 other upstream 2230203 35633473 ~ 35705333 (-)
G701618 LOC106571560 other upstream 2489471 35900623 ~ 35918175 (-)

Expression


LOC118965663 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 300.
End of interactive chart.

LOC118965663 Expression in each Bioproject

Bar chart with 18 bars.
LOC118965663 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network