XLOC_025781 (hbaa1)


Basic Information

Item Value
gene id XLOC_025781
gene name hbaa1
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 55100045 ~ 55100936 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00050653
GGACCAATTTCATGGGTGTGCCCTTCTTTCGTTTTATATAAAAAGTAGGACACATGCCTTGTTCCCCAACAGCTTTTTCTGAAGAAACCTCACTTGAGAAAAAGAAAACGCAGCGATGAGTCTCTCTGATACGGACAAGGCTGTTGTTAAGGCCATCTGGGCTAAGATCAGCCCCAAGGCCGATGAAATTGGTGCTGAAGCCCTCGCCAGAATGCTGACCGTCTACCCTCAAACCAAGACCTACTTTTCTCACTGGGCTGACTTGAGCCCTGGGTCTGGTCCCGTGAAGAAGCACGGAAAGACTATCATGGGTGCCGTCGGCGAAGCTATTTCAAAAATAGACGACCTTGTGGGAGGACTGGCCGCCCTGAGCGAACTCCATGCCTTCAAGCTGCGTGTTGACCCGGCCAACTTCAAGATCCTGTCACACAATGTCATTGTGGTCATCGCCATGCTCTTCCCTGCAGACTTCACCCCTGAGGTTCACGTGTCAGTCGACAAGTTCTTTAATAACTTGGCCCTGGCTCTCTCTGAGAAGTACCGCTAAACCTCAAGTGGATATTCACTGACAACAACACTGTGCGGCACTCTTAACAACTCATGCATGATGTTGGAATGAAATTTCTCAATAAAAGGCACAGAACTAAATGA

Function

symbol description
hbaa1 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Acts upstream of or within response to hypoxia. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Is expressed in eye; hematopoietic system; presumptive blood; and vasculature. Human ortholog(s) of this gene implicated in Heinz body anemia; alpha thalassemia; familial erythrocytosis 7; and hemoglobin H disease. Orthologous to several human genes including HBZ (hemoglobin subunit zeta).

GO:

id name namespace
GO:0042744 hydrogen peroxide catabolic process biological_process
GO:0015671 oxygen transport biological_process
GO:0001666 response to hypoxia biological_process
GO:0031838 haptoglobin-hemoglobin complex cellular_component
GO:0005833 hemoglobin complex cellular_component
GO:0005506 iron ion binding molecular_function
GO:0019825 oxygen binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0004601 peroxidase activity molecular_function
GO:0043177 organic acid binding molecular_function
GO:0005344 oxygen carrier activity molecular_function
GO:0031720 haptoglobin binding molecular_function
GO:0020037 heme binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-980526-79 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Acts upstream of or within response to hypoxia. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Is expressed in eye; hematopoietic system; presumptive blood; and vasculature. Human ortholog(s) of this gene implicated in Heinz body anemia; alpha thalassemia; familial erythrocytosis 7; and hemoglobin H disease. Orthologous to several human genes including HBZ (hemoglobin subunit zeta).

Ensembl:

ensembl_id ENSDARG00000097011

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00050653 True 651 mRNA 0.49 3 55100045 55100936

Neighbor

gene id symbol gene type direction distance location
XLOC_025780 hbaa2 coding upstream 5646 55093581 ~ 55094399 (+)
XLOC_025779 mpg coding upstream 56895 55031685 ~ 55043150 (+)
XLOC_025778 aanat2 coding upstream 206339 54887782 ~ 54893706 (+)
XLOC_025777 mgrn1b coding upstream 224171 54849083 ~ 54875874 (+)
XLOC_025776 NA coding upstream 263528 54834509 ~ 54836517 (+)
XLOC_025782 si:ch211-5k11.8 coding downstream 4130 55105066 ~ 55105966 (+)
XLOC_025783 hbbe1.1 coding downstream 13161 55114097 ~ 55114874 (+)
XLOC_025784 hbbe1.2 coding downstream 21726 55122662 ~ 55123439 (+)
XLOC_025785 hbbe1.3 coding downstream 30353 55131289 ~ 55132052 (+)
XLOC_025786 si:dkey-114l24.2 coding downstream 187264 55288200 ~ 55290637 (+)
XLOC_025429 BX649540.1 misc upstream 24851009 30248739 ~ 30249036 (+)
XLOC_025769 NA non-coding upstream 763406 54332726 ~ 54336639 (+)
XLOC_025768 NA non-coding upstream 796421 54289678 ~ 54303624 (+)
XLOC_025767 NA non-coding upstream 815860 54283767 ~ 54284185 (+)
XLOC_025766 NA non-coding upstream 828700 54270703 ~ 54271345 (+)
XLOC_025787 CT583658.1 non-coding downstream 198107 55299043 ~ 55299158 (+)
XLOC_025788 NA non-coding downstream 285279 55386215 ~ 55387657 (+)
XLOC_025789 NA non-coding downstream 381184 55482120 ~ 55488241 (+)
XLOC_025790 NA non-coding downstream 545937 55646873 ~ 55654264 (+)
XLOC_025791 FP326652.1 non-coding downstream 998320 56099256 ~ 56107909 (+)

Expression


Co-expression Network