XLOC_025782 (si:ch211-5k11.8)


Basic Information

Item Value
gene id XLOC_025782
gene name si:ch211-5k11.8
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 55105066 ~ 55105966 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00050654
GGTTCGGACTGATTTCATGGGTGTGCCCTCGTTTGGTTTTATATAAAAAGTAGGACACATGTCGTGTTCCCCAACAGCTTTTTCTGAAGAAACCTCACTTGAGAAAAAGAAGACGCAGCGATGAGTCTCTCTGATAAGGACAAGGCTGTTGTTAAGGCCATCTGGGCTAAGATCAGCCCCAAGGCCGATGAAATTGGTGCTGAAGCCCTCGCCAGAATGCTGACCGTCTATCCTCAGACCAAGACCTACTTCTCTCACTGGTCTGACTTGAGCCCTGGGTCTGGTCCCGTGAAGAAGCACGGAAAGACTATCATGGGTGCCGTCGGCGAAGCTATTTCAAAAATAGACGACCTTGTGGGAGGACTGGCCGCCCTGAGCGAACTTCATGCCTTCAAGCTGCGTGTTGACCCGGCCAACTTCAAGATCCTGTCACACAATGTCATTGTGGTCATCGCCATGCTCTTCCCTGCAGACTTCACCCCTGAAGTTCACGTGTCAGTCGACAAGTTCTTTAATAACTTGGCCCTGGCTCTCTCTGAGAAGTACCGCTAAACCTCAAGTGGATATTCACTGACAACAACACTGTGCGGCACTCTTAACAACTCATGCATGATGTCTGAATGAAATTTCTCAATAAAAGGCACAGAACTAAATGAG

Function

symbol description
si:ch211-5k11.8 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Predicted to be involved in hydrogen peroxide catabolic process. Predicted to act upstream of or within oxygen transport. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Orthologous to human HBZ (hemoglobin subunit zeta).

GO:

id name namespace
GO:0042744 hydrogen peroxide catabolic process biological_process
GO:0015671 oxygen transport biological_process
GO:0031838 haptoglobin-hemoglobin complex cellular_component
GO:0005833 hemoglobin complex cellular_component
GO:0005506 iron ion binding molecular_function
GO:0019825 oxygen binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0004601 peroxidase activity molecular_function
GO:0043177 organic acid binding molecular_function
GO:0005344 oxygen carrier activity molecular_function
GO:0031720 haptoglobin binding molecular_function
GO:0020037 heme binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-131121-640 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Predicted to be involved in hydrogen peroxide catabolic process. Predicted to act upstream of or within oxygen transport. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Orthologous to human HBZ (hemoglobin subunit zeta).

Ensembl:

ensembl_id ENSDARG00000079078

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00050654 True 657 mRNA 0.49 3 55105066 55105966

Neighbor

gene id symbol gene type direction distance location
XLOC_025781 hbaa1 coding upstream 4130 55100045 ~ 55100936 (+)
XLOC_025780 hbaa2 coding upstream 10667 55093581 ~ 55094399 (+)
XLOC_025779 mpg coding upstream 61916 55031685 ~ 55043150 (+)
XLOC_025778 aanat2 coding upstream 211360 54887782 ~ 54893706 (+)
XLOC_025777 mgrn1b coding upstream 229192 54849083 ~ 54875874 (+)
XLOC_025783 hbbe1.1 coding downstream 8131 55114097 ~ 55114874 (+)
XLOC_025784 hbbe1.2 coding downstream 16696 55122662 ~ 55123439 (+)
XLOC_025785 hbbe1.3 coding downstream 25323 55131289 ~ 55132052 (+)
XLOC_025786 si:dkey-114l24.2 coding downstream 182234 55288200 ~ 55290637 (+)
XLOC_025787 CT583658.1 coding downstream 193077 55299043 ~ 55299158 (+)
XLOC_025429 BX649540.1 misc upstream 24856030 30248739 ~ 30249036 (+)
XLOC_025776 NA non-coding upstream 268549 54834509 ~ 54836517 (+)
XLOC_025769 NA non-coding upstream 768427 54332726 ~ 54336639 (+)
XLOC_025768 NA non-coding upstream 801442 54289678 ~ 54303624 (+)
XLOC_025767 NA non-coding upstream 820881 54283767 ~ 54284185 (+)
XLOC_025766 NA non-coding upstream 833721 54270703 ~ 54271345 (+)
XLOC_025788 NA non-coding downstream 280249 55386215 ~ 55387657 (+)
XLOC_025789 NA non-coding downstream 376154 55482120 ~ 55488241 (+)
XLOC_025790 NA non-coding downstream 540907 55646873 ~ 55654264 (+)
XLOC_025791 FP326652.1 non-coding downstream 993290 56099256 ~ 56107909 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G24631 NA non-coding CI01000004 null 1041298 ~ 1041503 (+)
grasscarp (Ctenopharyngodon idella) G331263 NA non-coding CI01000113 null 254754 ~ 324930 (+)