XLOC_025783 (hbbe1.1)


Basic Information

Item Value
gene id XLOC_025783
gene name hbbe1.1
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 55114097 ~ 55114874 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00050655
ACAGCACTCTTCAGCTTCTGTTTAAGACACTTAGTCTGAACATCTAAAGTCGAAAACATGGTTGTGTGGACAGACTTCGAGAAGGCCACCATTCAAGATATCTTCGCCAAGGCTGACTACGACGTCATCGGTCCTCAGGCTCTGGCAAGGTAATGAGTCTTGGAGCTTATATTAACTTATATTTATAACATTACATAAGGCAGGAGACTGGTTTCGagacagctgctctaataaaaTTTGTTTTCATCAGGTGTCTCATCGTGTACCCCTGGACTCAGCGGTACTTCGCCAAGTTTGGAAACCTCTACAATGCCGCTGCCATCCTGGGAAACCCAATGGTTGCTGCCCACGGTAAAACTGTGCTCAAGGGTCTGGAGCTGGCAGTGAAGAACATGGACAACATCAAGGCCACCTATGCTGATTTAAGTGTGCTGCACTCCGAGAAGCTCCACGTAGATCCCGACAACTTCAGGCTTTTGGCTGATTGCTTGACCATCGTTGTTGCTGCTCAGATGGGTGCTGGATTCACACCTGAAGTTCAGGCCGCTTTCCAGAAATTCATCGCTG
>TCONS_00050656
ACAGCACTCTTCAGCTTCTGTTTAAGACACTTAGTCTGAACATCTAAAGTCGAAAACATGGTTGTGTGGACAGACTTCGAGAAGGCCACCATTCAAGATATCTTCGCCAAGGCTGACTACGACGTCATCGGTCCTCAGGCTCTGGCAAGGTGTCTCATCGTGTACCCCTGGACTCAGCGGTACTTCGCCAAGTTTGGAAACCTCTACAATGCCGCTGCCATCCTGGGAAACCCAATGGTTGCTGCCCACGGTAAAACTGTGCTCAAGGGTCTGGAGCTGGCAGTGAAGAACATGGACAACATCAAGGCCACCTATGCTGATTTAAGTGTGCTGCACTCCGAGAAGCTCCACGTAGATCCCGACAACTTCAGGCTTTTGGCTGATTGCTTGACCATCGTTGTTGCTGCTCAGATGGGTGCTGGATTCACACCTGAAGTTCAGGCCGCTTTCCAGAAATTCATCGCTGTCGCCGTGTCCGCTCTGGGAAGACAGTACCACTAAATACAGACAGAGAGAGATTATAATGTTTCCACTAAAGAATGTGCTATTCTGAGTTGAAGCAAATAAATATTTCACTATTCAA

Function

symbol description
hbbe1.1 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Predicted to be involved in hydrogen peroxide catabolic process. Predicted to act upstream of or within oxygen transport. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Is expressed in several structures, including ball; hematopoietic cell; hematopoietic system; mesoderm; and vasculature.

GO:

id name namespace
GO:0016999 antibiotic metabolic process biological_process
GO:0017001 antibiotic catabolic process biological_process
GO:0042743 hydrogen peroxide metabolic process biological_process
GO:0030154 cell differentiation biological_process
GO:0042744 hydrogen peroxide catabolic process biological_process
GO:0006942 regulation of striated muscle contraction biological_process
GO:0051187 obsolete cofactor catabolic process biological_process
GO:0048856 anatomical structure development biological_process
GO:0048869 cellular developmental process biological_process
GO:0015669 gas transport biological_process
GO:0015671 oxygen transport biological_process
GO:0032502 developmental process biological_process
GO:0048066 developmental pigmentation biological_process
GO:0030318 melanocyte differentiation biological_process
GO:0030900 forebrain development biological_process
GO:0072593 reactive oxygen species metabolic process biological_process
GO:0044445 obsolete cytosolic part cellular_component
GO:0031838 haptoglobin-hemoglobin complex cellular_component
GO:0005833 hemoglobin complex cellular_component
GO:0016684 oxidoreductase activity, acting on peroxide as acceptor molecular_function
GO:0043565 sequence-specific DNA binding molecular_function
GO:0019825 oxygen binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0046906 tetrapyrrole binding molecular_function
GO:0004601 peroxidase activity molecular_function
GO:0016209 antioxidant activity molecular_function
GO:0140104 molecular carrier activity molecular_function
GO:0043177 organic acid binding molecular_function
GO:0005344 oxygen carrier activity molecular_function
GO:0031720 haptoglobin binding molecular_function
GO:0020037 heme binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030616-7 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Predicted to be involved in hydrogen peroxide catabolic process. Predicted to act upstream of or within oxygen transport. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Is expressed in several structures, including ball; hematopoietic cell; hematopoietic system; mesoderm; and vasculature.

Ensembl:

ensembl_id ENSDARG00000113599

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00050655 False 567 lncRNA 0.48 2 55114097 55114757
TCONS_00050656 True 583 mRNA 0.48 3 55114097 55114874

Neighbor

gene id symbol gene type direction distance location
XLOC_025782 si:ch211-5k11.8 coding upstream 8131 55105066 ~ 55105966 (+)
XLOC_025781 hbaa1 coding upstream 13161 55100045 ~ 55100936 (+)
XLOC_025780 hbaa2 coding upstream 19698 55093581 ~ 55094399 (+)
XLOC_025779 mpg coding upstream 70947 55031685 ~ 55043150 (+)
XLOC_025778 aanat2 coding upstream 220391 54887782 ~ 54893706 (+)
XLOC_025784 hbbe1.2 coding downstream 7788 55122662 ~ 55123439 (+)
XLOC_025785 hbbe1.3 coding downstream 16415 55131289 ~ 55132052 (+)
XLOC_025786 si:dkey-114l24.2 coding downstream 173326 55288200 ~ 55290637 (+)
XLOC_025787 CT583658.1 coding downstream 184169 55299043 ~ 55299158 (+)
XLOC_025788 NA coding downstream 271341 55386215 ~ 55387657 (+)
XLOC_025429 BX649540.1 misc upstream 24865061 30248739 ~ 30249036 (+)
XLOC_025776 NA non-coding upstream 277580 54834509 ~ 54836517 (+)
XLOC_025769 NA non-coding upstream 777458 54332726 ~ 54336639 (+)
XLOC_025768 NA non-coding upstream 810473 54289678 ~ 54303624 (+)
XLOC_025767 NA non-coding upstream 829912 54283767 ~ 54284185 (+)
XLOC_025766 NA non-coding upstream 842752 54270703 ~ 54271345 (+)
XLOC_025789 NA non-coding downstream 367246 55482120 ~ 55488241 (+)
XLOC_025790 NA non-coding downstream 531999 55646873 ~ 55654264 (+)
XLOC_025791 FP326652.1 non-coding downstream 984382 56099256 ~ 56107909 (+)

Expression


Co-expression Network