LOC118965625



Basic Information


Item Value
gene id LOC118965625
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49983389 ~ 49986205 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>LOC118965625
ATGAAGCCATCATTTGCCCTCGTCTTGCCTCTCCTCCTCATACCCTTCATCAGTGCCCAGGTACCCCACTGGGGGCCTTGTCCAGAACCAGCCGTCCAGCCTGCCTTCAGCATGAAAAAGTTCATGGGAAGATGGTTTGAAATCAGCAAACTGCCAGCCCAGTTTGAGAAGGGGAGATGCATCGAGACCAACTTCTCCATGAAGGGCTGATCAGACTATTCGAGTGGTCAGCTCTGAAATATTAAAGGAAGAGCTAAGGATTATTGAGGGGAGTCACCGAGGACTTGAAGAACCCAGCCAAGTTGGGCATCAGCTACTCTTACGCCTGA

Function


NR:

description
PREDICTED: apolipoprotein D

GO:

id name namespace
GO:0006810 transport biological_process
GO:0005576 extracellular region cellular_component
GO:0005215 transporter activity molecular_function
GO:0008289 lipid binding molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
LOC118965625 True 329 mRNA 0.51 4 49983389 49986205
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530012 LOC106568711 coding downstream 13307 49964914 ~ 49970082 (-)
LOC110530011 LOC106568709 coding downstream 46388 49866272 ~ 49937001 (-)
LOC118965522 NA coding downstream 97163 49881643 ~ 49886226 (-)
zgc:110269 LOC106568705 coding downstream 328231 49647933 ~ 49655158 (-)
LOC110530006 LOC106568704 coding downstream 335541 49635475 ~ 49647848 (-)
LOC110530015 LOC106568800 coding upstream 107292 50093497 ~ 50095929 (-)
LOC110530016 LOC106568717 coding upstream 351526 50337731 ~ 50366270 (-)
LOC110530021 LOC106568720 coding upstream 426775 50412980 ~ 50434788 (-)
LOC110530027 LOC106568725 coding upstream 679426 50665631 ~ 50674317 (-)
LOC110530028 LOC106568726 coding upstream 691967 50678172 ~ 50685258 (-)
G718598 NA non-coding downstream 35266 49947768 ~ 49948123 (-)
G718594 NA non-coding downstream 39161 49943716 ~ 49944228 (-)
G718590 NA non-coding downstream 48353 49934833 ~ 49935036 (-)
G718581 NA non-coding downstream 58509 49924642 ~ 49924880 (-)
G718580 NA non-coding downstream 59061 49924061 ~ 49924328 (-)
G718625 NA non-coding upstream 8721 49994926 ~ 50001193 (-)
G718663 LOC106568713 non-coding upstream 65240 50051445 ~ 50059575 (-)
G718648 LOC106568713 non-coding upstream 82308 50068513 ~ 50071983 (-)
G718780 NA non-coding upstream 254796 50241001 ~ 50241249 (-)
G718781 NA non-coding upstream 255459 50241664 ~ 50241894 (-)
G718489 NA other downstream 145693 49785674 ~ 49837696 (-)
G716488 NA other downstream 1194427 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 1200874 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 1222226 48759912 ~ 48761163 (-)
G719151 NA other upstream 950723 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 1266150 51252355 ~ 51259061 (-)
G721275 NA other upstream 2774834 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 3476977 53462034 ~ 53478913 (-)
G722459 NA other upstream 3511943 53495804 ~ 53499730 (-)

Expression


LOC118965625 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.5.
End of interactive chart.

LOC118965625 Expression in each Bioproject

Bar chart with 1 bar.
LOC118965625 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.5.
End of interactive chart.

Co-expression Network