LOC118965689



Basic Information


Item Value
gene id LOC118965689
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51749224 ~ 51749294 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005053067.1
GAGTGAAATGATGGCATTTCATCTTTCGGGACAGACCTGATAATGGTGACTACTTTTTAGACTGATCACTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005053067.1 True 71 mRNA 0.41 1 51749224 51749294
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965688 NA coding downstream 5169 51743877 ~ 51744055 (-)
si:dkey-18p12.4 LOC106568750 coding downstream 59879 51648538 ~ 51689345 (-)
LOC110530053 LOC106568748 coding downstream 157341 51583525 ~ 51591883 (-)
LOC110530052 LOC106568747 coding downstream 166869 51560800 ~ 51582355 (-)
LOC110530051 LOC106568746 coding downstream 202290 51525267 ~ 51546934 (-)
LOC118965644 NA coding upstream 456 51749750 ~ 51749819 (-)
LOC118965691 NA coding upstream 816 51750110 ~ 51750180 (-)
LOC118965690 NA coding upstream 1252 51750546 ~ 51750616 (-)
LOC110530061 LOC105030384 coding upstream 45805 51795099 ~ 51805210 (-)
LOC110530062 LOC106568754 coding upstream 64294 51813588 ~ 51838600 (-)
G720009 NA non-coding downstream 27254 51721673 ~ 51721970 (-)
G720003 NA non-coding downstream 32481 51716467 ~ 51716743 (-)
G719994 NA non-coding downstream 40674 51708305 ~ 51708550 (-)
G719993 NA non-coding downstream 41113 51707790 ~ 51708111 (-)
G719992 NA non-coding downstream 42512 51706457 ~ 51706712 (-)
G720112 NA non-coding upstream 9989 51759283 ~ 51763591 (-)
G720399 LOC106568761 non-coding upstream 305936 52055230 ~ 52059713 (-)
G720409 NA non-coding upstream 323471 52072765 ~ 52073121 (-)
G720410 NA non-coding upstream 325875 52075169 ~ 52075471 (-)
G720413 NA non-coding upstream 332248 52081542 ~ 52081769 (-)
LOC110530043 LOC106568739 other downstream 490205 51252355 ~ 51259061 (-)
G719151 NA other downstream 809753 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 1859972 49866272 ~ 49937001 (-)
G718489 NA other downstream 1911528 49785674 ~ 49837696 (-)
G716488 NA other downstream 2960262 48788521 ~ 48788962 (-)
G721275 NA other upstream 1011745 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 1713888 53462034 ~ 53478913 (-)
G722459 NA other upstream 1748854 53495804 ~ 53499730 (-)
G722602 NA other upstream 2054149 53803443 ~ 53856065 (-)
G722670 NA other upstream 2176934 53926228 ~ 53927959 (-)

Expression


LOC118965689 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

LOC118965689 Expression in each Bioproject

Bar chart with 7 bars.
LOC118965689 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network