LOC118965691



Basic Information


Item Value
gene id LOC118965691
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51750110 ~ 51750180 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005053069.1
GAGTGAAATGATGGCTTTTCATCTTTTGGGACAGACCTGATGATGGTGACTACTTTTTATTCTGATCACTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005053069.1 True 71 mRNA 0.39 1 51750110 51750180

Neighbor


gene id symbol gene type direction distance location
LOC118965644 NA coding downstream 291 51749750 ~ 51749819 (-)
LOC118965689 NA coding downstream 816 51749224 ~ 51749294 (-)
LOC118965688 NA coding downstream 6055 51743877 ~ 51744055 (-)
si:dkey-18p12.4 LOC106568750 coding downstream 60765 51648538 ~ 51689345 (-)
LOC110530053 LOC106568748 coding downstream 158227 51583525 ~ 51591883 (-)
LOC118965690 NA coding upstream 366 51750546 ~ 51750616 (-)
LOC110530061 LOC105030384 coding upstream 44919 51795099 ~ 51805210 (-)
LOC110530062 LOC106568754 coding upstream 63408 51813588 ~ 51838600 (-)
LOC110530931 LOC106568756 coding upstream 166706 51916886 ~ 51976908 (-)
LOC110530932 NA coding upstream 242126 51992306 ~ 52006456 (-)
G720009 NA non-coding downstream 28140 51721673 ~ 51721970 (-)
G720003 NA non-coding downstream 33367 51716467 ~ 51716743 (-)
G719994 NA non-coding downstream 41560 51708305 ~ 51708550 (-)
G719993 NA non-coding downstream 41999 51707790 ~ 51708111 (-)
G719992 NA non-coding downstream 43398 51706457 ~ 51706712 (-)
G720112 NA non-coding upstream 9103 51759283 ~ 51763591 (-)
G720399 LOC106568761 non-coding upstream 305050 52055230 ~ 52059713 (-)
G720409 NA non-coding upstream 322585 52072765 ~ 52073121 (-)
G720410 NA non-coding upstream 324989 52075169 ~ 52075471 (-)
G720413 NA non-coding upstream 331362 52081542 ~ 52081769 (-)
LOC110530043 LOC106568739 other downstream 491091 51252355 ~ 51259061 (-)
G719151 NA other downstream 810639 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 1860858 49866272 ~ 49937001 (-)
G718489 NA other downstream 1912414 49785674 ~ 49837696 (-)
G716488 NA other downstream 2961148 48788521 ~ 48788962 (-)
G721275 NA other upstream 1010859 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 1713002 53462034 ~ 53478913 (-)
G722459 NA other upstream 1747968 53495804 ~ 53499730 (-)
G722602 NA other upstream 2053263 53803443 ~ 53856065 (-)
G722670 NA other upstream 2176048 53926228 ~ 53927959 (-)

Expression


LOC118965691 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

LOC118965691 Expression in each Bioproject

Bar chart with 3 bars.
LOC118965691 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network