trnav-cac-9



Basic Information


Item Value
gene id trnav-cac-9
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52485481 ~ 52485553 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnav-cac-9
gtttccgtagtgtagtggttatcacattcgcctcacacgcgaaaggtccccggttcgaaaccgggcggaaaca

Function


NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnav-cac-9 True 73 mRNA 0.56 1 52485481 52485553
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-aac-10 NA coding downstream 1234 52484175 ~ 52484247 (-)
trnav-cac-8 NA coding downstream 1436 52483973 ~ 52484045 (-)
LOC110530083 LOC106568812 coding downstream 9724 52465692 ~ 52475757 (-)
kif1ab NA coding downstream 48613 52379925 ~ 52436868 (-)
LOC110530080 LOC106568811 coding downstream 122363 52352804 ~ 52363118 (-)
trnav-aac-11 NA coding upstream 130 52485683 ~ 52485755 (-)
trnav-cac-10 NA coding upstream 1436 52486989 ~ 52487061 (-)
trnav-aac-12 NA coding upstream 1638 52487191 ~ 52487263 (-)
trnav-cac-11 NA coding upstream 2945 52488498 ~ 52488570 (-)
trnav-aac-13 NA coding upstream 3147 52488700 ~ 52488772 (-)
G721207 LOC106584099 non-coding downstream 25822 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 76253 52408868 ~ 52409228 (-)
G721149 LOC100136012 non-coding downstream 193136 52291980 ~ 52292345 (-)
G721148 NA non-coding downstream 193561 52291672 ~ 52291920 (-)
G721110 dis3l2 non-coding downstream 240189 52243208 ~ 52245292 (-)
G721237 NA non-coding upstream 56 52485609 ~ 52538339 (-)
trnav-cac-22 NA non-coding upstream 18136 52503689 ~ 52600136 (-)
G721243 NA non-coding upstream 42850 52528403 ~ 52589826 (-)
G721245 NA non-coding upstream 47656 52533209 ~ 52668446 (-)
G721248 NA non-coding upstream 54527 52540080 ~ 52545734 (-)
LOC110530043 LOC106568739 other downstream 1226462 51252355 ~ 51259061 (-)
G719151 NA other downstream 1546010 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2596229 49866272 ~ 49937001 (-)
G718489 NA other downstream 2647785 49785674 ~ 49837696 (-)
G716488 NA other downstream 3696519 48788521 ~ 48788962 (-)
G721275 NA other upstream 275486 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 977629 53462034 ~ 53478913 (-)
G722459 NA other upstream 1012595 53495804 ~ 53499730 (-)
G722602 NA other upstream 1317890 53803443 ~ 53856065 (-)
G722670 NA other upstream 1440675 53926228 ~ 53927959 (-)

Expression


trnav-cac-9 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network