trnav-aac-23



Basic Information


Item Value
gene id trnav-aac-23
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52503113 ~ 52503185 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnav-aac-23
gtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggtccccggttcgagaccgggcggaaaca

Function


NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnav-aac-23 True 73 mRNA 0.51 1 52503113 52503185
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-cac-21 NA coding downstream 130 52502911 ~ 52502983 (-)
trnav-aac-22 NA coding downstream 1101 52501940 ~ 52502012 (-)
trnav-cac-20 NA coding downstream 1303 52501738 ~ 52501810 (-)
trnav-aac-21 NA coding downstream 2274 52500767 ~ 52500839 (-)
trnav-cac-19 NA coding downstream 2476 52500565 ~ 52500637 (-)
trnav-cac-22 NA coding upstream 899 52503689 ~ 52600136 (-)
trnav-aac-24 NA coding upstream 1101 52504286 ~ 52504358 (-)
trnav-aac-25 NA coding upstream 1520 52504705 ~ 52504777 (-)
trnav-aac-26 NA coding upstream 2819 52506004 ~ 52506076 (-)
trnav-aac-27 NA coding upstream 5091 52508276 ~ 52508348 (-)
G721235 NA non-coding downstream 12710 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 43454 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 93885 52408868 ~ 52409228 (-)
G721149 LOC100136012 non-coding downstream 210768 52291980 ~ 52292345 (-)
G721148 NA non-coding downstream 211193 52291672 ~ 52291920 (-)
G721243 NA non-coding upstream 25218 52528403 ~ 52589826 (-)
G721245 NA non-coding upstream 30024 52533209 ~ 52668446 (-)
G721248 NA non-coding upstream 36895 52540080 ~ 52545734 (-)
G721238 NA non-coding upstream 86034 52589219 ~ 52656589 (-)
LOC110530043 LOC106568739 other downstream 1244094 51252355 ~ 51259061 (-)
G719151 NA other downstream 1563642 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2613861 49866272 ~ 49937001 (-)
G718489 NA other downstream 2665417 49785674 ~ 49837696 (-)
G716488 NA other downstream 3714151 48788521 ~ 48788962 (-)
G721275 NA other upstream 257854 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 959997 53462034 ~ 53478913 (-)
G722459 NA other upstream 994963 53495804 ~ 53499730 (-)
G722602 NA other upstream 1300258 53803443 ~ 53856065 (-)
G722670 NA other upstream 1423043 53926228 ~ 53927959 (-)

Expression


trnav-aac-23 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network